Description :
From Genome Similarity Track
Location :
contig_68:88938- 91305
Transcript NameFunction/comments
g11353.t1hypothetical protein

Sequence
2367 bases(100 bases per row)
CGATAGCCTCTCTCCCACCCAAACTCGAAGACGGTGGCAACGATAGCGGTGTACGCGGATGCCGCAAGCCATTTACGTAAAATGGGGTGAAACCCGTCGA
CGAATGCACAGCATTATTCAGCGCAAACTCCACTTGGGGTAGCAGCGTGCTCCACTTGGTGGGTTCTTCAGCGCAGACGCTGCGCAGTACGTCTTCCAAC
ACACGGTTCACGCGCTCCGTCTGACCATCGGTCTGTGGATGGTCCGCTGTGGACATGTCCAATCTCGTACCGAGAAGACGGAACAAGTGTGTCCAAAAGT
GTGACACAAAGCGCGGATCTCGATCACTCACGAACGCCTCCGGGAGGCCATGGTGTCGAAAGACATTATCGACAAAGAGCTGTGCCGCTTGCGGCGCCGT
CACGCTCTTCTTTACCGCGACAAGCCGCACCATCTTGGTCAGTCTACAGACGAAGACCAAGATGCCAGTGTGGCCGCGCGTGTCCGCCGGAAGCTCAAAG
ATGAAATCCATGCTCACCGAGCGCCAACAGTCAGCCGGCACCGGCAAGCTCATCAATGGAGCCGACGACGATGGGGCGGGCTTCACGCGTTGGCACGTCT
CACACGTCTGCACGTACGTGCGCACCCACTTATACATATGTGGCCACCAGAAGTTGCGCGCCACAGACGTATACGTCTTCTCTCGGCCAAGATGACCGCT
GAGCGGCGTGTCGTGTGCCTCGTAGAGGACTCGATGACGTAAGTTCTCGTCGTTGGGAACCACGATACGGGGCTCGTCGCTTTCGTCTACCTGATAGTAG
AGAAGATCATCTGCTAGTGAGTAGCGGTGCAACCGTGAGCGCTGCCGAGCAGTGAGTTTCACAGCCTTTTCAGGCACCTTCAGTGAAGTTACGAGATCGG
CGAGATCGCCATCCTCTGCGTACGCCTCGCGTAGCAGCTCATAGAGTGGGGACTCGAGATACGCAACGTGCGCCAGCTCATAGTCCGGCGCCGGGACAAC
GCGTCCGCGAGGACGTTCTGCTTCCCTGGTTTGTACTCCACCGTGAAGTTATACTCCGCAAAGAAGGAGAGCCACCTCGCCATACGCTGGGAGAGGTGGG
GCGACGACGTCGCTGTCCGCAAAGACGCATGATCTGTGTAGATCACGAAGGGTTCGCTGCCAAGCAGGTGTACCCGAAACTTTACGAGCGCGTACTTCAT
CGCCAGAAGCTCCTTGTCATGGACAGGGTAGTTCTTTTCAGCCGCCTTGAGTTGGCGCGACTGGAAAGATACTACCCGTTCTCTGCCATCGGCATCGACC
TGAGCAGGGCACAGCCTATGGCGAAGTCGGATGCGTCGCATACCACACTGAAGGACGATCATCGTCGGGCAAAGCCAAAATCGGAGCGCTCTGCAGGCTG
CTTTTGATTGCCTCGAAAGCCTGCTGGGCTTCATCGTTCCACGACCATTCCGCCTCCTTCTTTAAGAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTAGT
TGGCGCTGTACTTGTGTAAGTAGTTGGCAAGGCCAAGCCACTTGCGCAAGTCCTTCTGGATACTGGCACTGGCCATTGTGCGATCGCGCATATCTTCTCA
GGGTCCGCACGGACACCATCCTTGCCAAGGAAACATCCCAAGAAGGGAATCTTCGGCTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGATTCTCG
CGCATGCACATCAATACCTCGCGGAGGTGGTTAACGTGCACTTCGACAGCCGTCTTCTCCTGAGGCACGACTGTGCACGAAGATCATCAAAGTACGTCTG
TACGAACTGCCGCATCGGCCGGAAGAGTTGAGTCACCATCGATTGAACGTGGCTGGTGCGTTCGACAGCCCCTGGGGCATCACGAGCCATTCCCACAGCA
TCCCGCTGGGTGTGCTCACCGCTGTGAGCGGGACGTCTGATTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGTCGAGTGCACTGAAGATGGTGCA
GCCCGCCATGTTGTTCTGTAACACGTCCTTGCGAGGGATTGGCGTGGACGCCGGGATGGTTGCTGCATTCAACTTGTTGAACGCATGTACCATACGCCAC
TTCCCATTGGGTTTACGCACGCAAAACGTCGGGACGAGTGCGGCGACTTTGACTCGCGCACCATGCCCGCGGCATTTTTCGCCGTGAAGAATGCGTCGAT
CACATCGACTTGCTCCTTCGGTAGTGGCCATTGGCGCGTGGTGCAATATTTGGTGCTCGGCACCAAATTGATCTCGTGTCGCACACCTCGATCTGGAGGT
AACACCGACGGTGGGTTATCGCTGACCACATCCGAGAACTCCTTCAAAAGGGGGTAGTACGGATCCG