Description :
From Genome Similarity Track
Location :
scaffold_47:88911- 90816
Transcript NameFunction/comments
g2042.t1 myosin-like protein

Sequence
1905 bases(100 bases per row)
TTCGGCCGAACTTGCCACGCACAATGGACTGAATCTTCACGGCTGCAGCGTTCTGCTCGGCAAGCTTCGTGGCCATCCGCTCGCGGGTCAGCAGCAAGAG
CTTCTTGAAAGCGTTGGAAGCGAGGACGCCACCAATCGCCATCTTCCAGTGCTTCTGGGCGAGTGCTTTACGGCGCGCTTTGAGGCGGTGCGCGTTACGA
GCACGGATGAACTGCTTGCGAACGGCAAACATGCGCATCACAGCCTGCATCTTGACGACGGCCGCCTTGCGTCTTCTGGTGTCCTCCAGCAGCCACAGGA
ATGCGCGCTGGGCGAGCACCTTGGCCAGGGCATAACGCCAGCGACGACGCGCAAGCCACTTACGAAGGCGAGCCACGATCCATGGCCCCATCTTCTTCAT
ATCGACCTTCAGCAGCGCATCCAGCAGAGCAATCTTGCCCGTCTTGAAGAACACCTTCGTGCGACCGAGACGGTAGGCATCAGGCTCCACGCGGAACGAC
CACAGCACGGCCTCCGTGAAGGTACGGTCGTTGTACGCGTTGAACATGGGCGTGACCGACGGCGGCAGCACAGGCTTGTAAATACGGCAGATCTCCTCGT
ACGCCACACGGGTGGGGAGACCGACCTTAAGCAGCTCACAGGTAGCGAGCATACCGGAGCAACGCAGCTGGTCCACAACGTAACCGTGGTCAAACACGCC
AGGAGACATCGTTGGGTTCGGCTTGATACACCGAATGAAGTTGCAGCGCGTCGCGTTCAGCGTGTCCGTCAGCTCCTGCATCTGGTCGCAGAACTTGGCC
GACACACTCTGCTTGTGCAGCTGGCTCGTGTTAACCGCGCTCCCCATAGTGTCCAGGTCCAGCTTGGACGAGAACAACTCCTTGATCAGCGAGGACTTGC
TGGACGTCACAAAGTCCTCCAGGTCCTTGGGAATCGTGTCGTTGTTCTTGTCGATGAAGTTGCCAATCGTGTACGGGACGCGCGTGGCAAAGTGCTTGAC
GATAAACTCGTACTTCTTGTCCTTCTCGTGAGGGGGCAGGAAGTGCGGGTGGCTCGAGTGCGTCTTGTGCAGCGTGGCGTTCCACTTCTCGTCGGACGGC
TTGGGCATCTTCGCCTCCTGGTCCAGCAGCGGCAGAATACCGTTCGGCTTCTGCGAGATCAGGTCGATACACTCGCGGTTGTCAGGCCACACGATCTTGC
CGACCTCGATACCTTCGGCTGCGAACAGCTCCTGCTCGGCAATGAAAACCTGCTGGTTGAACGTGGCCTGCAGAGCCTCATTGGCGTAGTTGATCAGCAG
CTGCTCGAAGTCATTCTCCTCGAAGGACTCGAAGCCGAAGATATCCAGCACGCCGATGAACGGCAGCGAGCTATCACCGTGGCCAAGCGAGCTGTTGATC
TTGTACAGGATCCACTTGAACAGGTGGTTGTACATCGACTTGGCAATGGCGTCACGCACGTAGCTTCCCTCCTTCGCCGAGCGCTTAATCGTAAAGTTCT
CCGTGCGCGTCGAGATCTCGCGCGTGGTAATCACGTGCAGCAGGTTGGTGCTGTCCACACCAAGCAGCTCCGCACACGACGCCACGTACTTCTGCGCCTC
TGGGGTCACCTCACCGGCGTCACCCTCCGCCGTCTCTCGGTCTTTCAAGCGGATGTTACCCAAGTGCAGCAAACCCGACAGAATCGTCCAGACCTGCTTC
TGCAGTCCAGCGTCAATGTTCACGGACGTCAGCGCACTCGCCACTTCGTCGAACAGGATCTCATCGTCCACGTTCGGGTCCGACACGCAGCCGCTCTGGT
TCAGGTATTCAAAGTTGTTAACAGGCTCCAGCTTCAGCTCCTTGGTCAGCGCGCTATCCGCTCCGGACAGCAAAAAGTAAAAGATGTGGAAGTTGCGCTC
CCCTG