Description :
From Genome Similarity Track
Location :
Scaffold_2784:889- 2555
Sequence
1666 bases(100 bases per row)
ACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACCCGCGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACC
ATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATACCTGTGTTTCCCGCCTTATCCTTGGGAAGGCCA
AACACAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGTTCGGCGCGGACTTTGTCCGTTGACACG
TCTCACACGTGCGTACATAGGTGCTGACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCC
GCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGCGTCGGTGCTGTAG
TACAGCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCCCAAGAGCCC
GTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAATTCGTAGTCCGG
CCTGCGCGGGAGCGCATCGGCCACTACATAAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTC
TGAGAGAGATGAGGCGGCTGTGTCGCAGTGCGTAGCGATGCATGATCAGTAAATATCACAAAAGACTTAGAGCCTAGCAGGTGTACCTTAAATTTGACTA
GAACATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAATTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCAATCACGCGTTCACGCCC
TACGGCGTCTGCTTGTAGATCGCGAGTCTCTTTGGAAACGTGTTCGTCTTGACCAGGGATTGATAGTAATGGCATTTTTGTCAAACTGATTAGTAATATT
TGGAAGACAAATTTTAACCTCATAACTATCAATAGAGATCTGGATCGGCATCGAACCTACAGTGGTTATTAATATTAATATTTCAGCTATTAATAAGGGC
CATTCTTTGTCTAATCAGGGACTTGAAGAGCGAAGCTCACGCGATTCTCTGAGATCAAGATACGGCTTGGACGTACGTCAGGCCGCTGGTAAGTGGAAAG
TTACAGTATTTACTCGAGGATGTAGCACTTGGTCGCGTTCCTGAGGCAAGGAAACGAGATATTTTGGCGGCTTTATTGCTCATTCGTTGTGGCTTTACTT
TTTCTTGGCTGTTGATTACATGTAGTTACACCGAAGCATCGAAATCAGTACAAGGATCGCATCATCATTAATCATATCGATCATAAAGCTAATCCAGCTT
GTAGCACCAGTTACTGCGAGCTGATTGTACATCACTAAGGTGAGTTGATTGGAATTATTTGCTAGACATGAGTGATTCTAGCGACTAAGTGACTTGAGTA
CTTATTGTCGTAGAGCAACGAGTATAATCGCGGCGATGGGGCGAACAGTGAAGATCGAAATGTCTA