Description :
From Genome Similarity Track
Location :
Scaffold_47:88894- 90328
Transcript NameFunction/comments
g12747.t1GAY04487.1 trehalose-phosphatase [Pythium insidiosum

Sequence
1434 bases(100 bases per row)
TGGTAGATGTCGAGCTAACGACCGCCCACCAGTACCTGTCTGTCTTGTCCAGGCAAATGGCGGCGTGCTCGATGACAGCTCTTGCCTCTCCGTCCTTCTA
GAGCCTCTTCGCGGCCCGATTGATCAACCATTTAGCAAACACACTTCAGCCTCGCCAGCTCCGTGAGGAATTGCTGCACCTCCGCCGTGTCCCGAAGAGA
GTACGACGCCTTCGTTACCGGCAGCTCCTTGAGGTTGCCTGGCAGGTCCACCTTCTCCGCCTCGGGGTCTCGTACGATGATGGAAATGCCCTGGCCCAGT
CCACGCCCGTTCAGCGCGTTGAAGGCATCCTCATCGCTCACGTCGTCGCCCAGGTAGAAGGGCACGACATCCTCCGCATCCAGTCCCAGCTCCGATAGGA
TGTACATGACAGCGCGACCCTTGTCCCAGTCAACCTGCAGATGATAACGCATGCGAGTCAGACACATAGAAAATCACGACATGCACCTCTCTCAGCACAG
ACATACCCGAGGTCGCAGCTCGAACACCATCTTGCCCATTTTCTTGGTGAGGCTCGGGTGGTAGTCCACGTAGTCGTCGACGATCTGCTCGACGGCGTTC
TGCAGCGCCGGATCAACCTGATCAGTGGCGAAGCACAAGACAGACGCGTTGGCATCGACCGAAGGAGATACAAAGTTCAACCCAGGCAGGCACAACATCC
TCGTCATGCAACACTCACGTGGCGGTAGTGGACCGAGATGGCGAGTCCGTTGTCCTCGAGCTCGGCGCCAGCGATGTGCGACGTCTGCTCCGTCAAGTCA
AGCAGCGCCTGCTCGAGCTCCGGGCGGAAGTGGTCAGCCACTTGGCAGTTGATGGGGCGCGTCTTGGTGCCCTTTATGTCGAACCCGTGGCTGCCAGCGT
ACACCAAGTTGTCCAGCTGCACGAAGTTGTAGACCTTCTCCGTGGAGCGGCCCGTGACGATCGCCGTGACGAACTTAGACGAGAGCTCGCTGAGAGCGGC
GCGCATGGCGTCCGTCATGAAGGCGTGATCGGGCACGTCCACGATGGGCGACAGCGTGCCATCGTAGTCCAGGAAGACAACAGGACGCTTGCCTGCATTG
GCATTTAACAGCAAAAGTCAGAACCCCATAGACACGTCGAGACACCAAGCAGCGGTAGCAGCGGTAACCAATCCGACTGGTCGGTTACGAGTCCAAATTG
TACAGCTCTAGCTCCAGCTACTTACCGGCGACTTTCTGCCGGATGGCGTCCATGTCAAGGAACGCGTTGGTCGGGTGCAGCATACTGGCCGAACGCGAGA
ATTCTTGGAGCCTGTGGGTCGCTGGACTGCAGCAGTTTCGATTCGGAGGCGGACAGACGGCACCTGCGCTGGCTGCTGCTGGCTGCGCAGACGCCTGGAG
GCTGTGCTGAGCTCGCGCTCGCTAGGCCGGAGGC