Description :
From Genome Similarity Track
Location :
Scaffold_963:8888- 11317
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_963-fgenesh-gene-0.1TWISTNB protein
Pytul_var.sporangiiferummaker-pug3_contig_963-fgenesh-gene-0.3Tubulin-specific chaperone C

Sequence
2429 bases(100 bases per row)
AGGTGCGCCACAATGTGAGCCTGTCGCCGTGCCACATCGCCGAGCCGCGCGTGGGCATCGAGCAGGAGATGACGAGTCTGCTCATGCGCTACTCGGAGCA
GCTCGAGGGCGTGATCCTGTCGTTCAGCAACGTGAAGCTCGACAAACCGTTTGGTCACATCGTGAACGAGATGCCGTATATCCACTGCAAGGTGCTCGCG
GACGCGCTCTTGTTCCAGCCGAAGGAGGGCATGGTGCTCAAGGGCACTGTCAACAAGATCGGCAGCAACCACATCGGTATGCTCTTTGCGGGCGTCTTCA
ACGGCTCCGTCGCGGCGTCCGAGCTGCCCAAGGGATACGTGCACAACTACGCCCAGGACGCATGGTACGCTCATTTATTGAAGTTGCATAGATCATGGAA
TGCTCTTGCTGATGCGTATGTTGTGTCTGTTTAATGGTGCAGGCTGGACCAGTTTGGCAACCAAATTGCCGTGAATGACACGGTCGAAGTCAAAGTGCTG
AGGTATGGCTTCGTGTATCGCTCCTTCTATCTTTCGAATATGGGAAACTCACCTCTATCGTGTCTATTTAAACAGAGTACACGTCGCTGGCGGAATGATC
GCCATCGAGGGGTCCATGTGCAGTGTTGGCGCTGCGTCGTCCAAGAAGACGAAGAAAGCACAGGCAGCTGAGTCGATTACCTCGCCATCGCCAAAGAAAT
CCTCCACAAAGAAGGCGAAGCACGCCGCCAACGATGAAGCCGAGCCGAGCAGCAAGAAAGCGTCCAAGAAGCGCAAAAACGACGAGGGCGAAGCGCCAGT
AGAAGCAGCAGGAACCAAATCCAAAAAGAAGGACGCGTCCAAGAAAAAATCCAAGAAAGAATGAGCGCTATCATACCAGCAGTAAACCAGACAACCAACA
TAGATCGCTAGGCTATACGGAAACAGGCAGTGCATCTATCACAAGATAGAACAAGCAAGCAAGCGCACGCGCAAGCCCCAGCAGCAAATACACATTTAAA
TATTCATTCTGTATTGACTCGAACGCTCTCATTAAGTCAGCATCACTACCACTTCACTACTGCAAGCTGATGAGCCCCTCGAGGCGCGCTGGCACGGGTT
TCAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGACGCTCCAGTTCGGCGATTGCTGCGCCTTGTGCCACTTGAAGTCGTTCACGCG
CGACCAGAGCCCATTGTCCTTGAGCAAGCCCACTTTCTCGAGCTGCTCGTCGAGGCCGTCAAAGTGGAGTCGGTATGGTCCAAACTTCATCTGATGGCAG
TCCTCGATGATCGGGTGGCTGCTGATGCGCAAGTGGAACGTCGTGGCCTGACTCAAGTGCACGCGAAGCTGCCGACACGCAACGAAAAACTCGCATGACA
CGCAGTTCTCGAGCCACATGCTGCCCCACACCGGCGCCGTGTAGATCGTGCACTGCTTCAGGTCATCGCCGCGAATCGCCGACGTCTCGACGCACACAAA
GATCGTGCAGTTGGTCAAGTGCGAAAAGTTGAGATCGCGACGCTTGGTCGTAGAATCGTCGGAAAAGCTCTGCTGGTCCACGATGATCATCTCGTTCTGC
CGATTCGCGTACACCAGTTCGTCCATGTTGGCAAACAGGTTGCTGCTCTGCGAGTCGGTCTTGGTGTCATTGCTCTCGTTTTCGGGCTTGTCGTCATTAC
TGCCATTATTATCTTCTTTTGTCAGCGCTTTTTTGGCGCGTGCACGGAATGTGAACTTCTTGCGCGGTGCAAACGTCGTGCGCGTCGTTTCCACGAGCTC
CAGGAGCTTCGAGACGATGATCTGCGACTGTCGGATATCGTACGGCGACAAGTACATGGACGCCGCGGACGCTGCGTCGTCGCGCATCTCGCCGATGCGC
AGCACGAGGTCGTCCAACTGGATCTCCTTGTTCTTGTCACACGGCGTCGGCTGTTTCTTTTGCTCGACAAACGCACCAATCTGCTTGCGGATCTCGTCTT
CGCGCGCTGTAAACCGCTTCCAAAAACTCTGCACAAGATCATCCGCATTCAGCTCATGATTCTGTTCACGAGTCGCTTTCTCAAGCTGCTTCTTGTCTTC
AGCGGCCTTGCGTCGCTCGTTCAAGTCGTACTCAATGCTCTCAGCGTGGGTCGCGAGGATCGGGAACTCACCGACCGTGTTCAGTTTTTCCTTGCGCACG
AACGCACCATGCAGTCGCGGACACGTGAAGTACGCCACGCCGTCGTACGAGCCGTCGTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCGGGGAGTCCTCGCACGGCGCCGATGTACGCGACCTCGCCGTACCGCTTGATGCTGGCGCGCAGACCGCCACTTGTGCT
CGAGGACAACAGCTCGCAGCGCATGCCGA