Description :
From Genome Similarity Track
Location :
Scaffold_159:88862- 90152
Sequence
1290 bases(100 bases per row)
CTGGACCTGGGCGCACGATCACGGCCACCTACACTTCGGTGCCGCGTCGTGGTGGTGCACCGTCGGTTGAGCCGTTGCCTCACCAAGTGTTGCCTGGGGC
TCGCCCTACGGTGCCGGCTTCGTCCACCTTGCCACCGTGAGTTCTTCCGTACTTGGCCATGGCGTTTACTGACGCAGGGGCCAAGAAGTGTTTCGAGCGA
CTCTTAAGCATGACCCTCCCCGAACCAACTGGTGAGGTGACCGTCCGTACGACGTTGGAGGGTCTCCAAGCGTACTTTGACTATTCGCATCCTGATCATC
CGTACCAGCAACTTCGGAAGCTTTACCCTCTTCAAGCGTGTCTCTTCGACACCGTCGACCTCGATCCTAGCGTTCCCATCTCGAAGCGTGCTCCGATTGA
GACTCGTCTCAAGATGATCTGGGCGAACCGTCTGGGTGACGGCGGTAAGCAAGGTGACCTCGGGTTCGCTTTGTGGGAGCGTCTCCACTGTATTCCGTTG
GCTGATATTGAGCGAGGTCTCGTTGAAGAAGCTAAAAAGGCTGGCCATGACAAGGAGCGCTTGAAGGAACTGAGAGCTCTGTTGAAGAAGCTCTTCAGTG
GGCGCGACCGTCGTGCCGATCGTCTTCGTAACCAGTACCGTGAACAATACATGGCGTGGAGTCGTGACTCGATTTCCTCTGGTATCTCCGGTGCGCCGTT
CATTCGTCCTGAGCTGCTTTTGGAGCCGTCGAAGCCATGGTACCCGATCGAGAACTTGCCGTTCGCACCTCGGACTTCCGACTAGCTTTCCGAAGTTCCG
GCTCTAGATGCTCGTCAACCCTGGCGTACTGGATGGACGAATGCGCCGCATCAGCACCCGTACAACACCACGTACTTCCCGTGCCAATGTAATCCGGAGC
TCTTCAATCCTCGTGGTACGCGTTTCGTGAATGTGTACCGAAGCGTGCTCGTTGACCCGTCTCGGGATTCTACTGAAGATATTCCGACCTGGCGTTCGTT
GTTTGACTCGCCACCGGCTACTCCACGTCCCGCTCTGGCTGCTGCTTCTGTTGAAGCTAGTGCCGATGATTCGCAGGGTCCGGCTCCAGCTCCAGCTGCC
GAGGCTCAGGCTCCTGATGAAGAAGAGAAGGAGAGTGGTGACTCGACTTCGTTGGCACTCTTGACCACCGCGACCAGGCAATTGGAATCGCATAGAATCC
TCGCTGCATGTTCCACGACGTTCTCCAGCATCTCAGCTAGCTGTTGAGGGGTCCAGCGAAGCTTATTTTTTCAGTGGTCGCTCCCCGGTC