Description :
From Genome Similarity Track
Location :
Scaffold_538:8884- 10173
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_538-abinit-gene-0.30Nicotinate-nucleotide pyrophosphorylase
Pytul_var.sporangiiferummaker-pug3_contig_538-snap-gene-0.13Serine protease family S10

Sequence
1289 bases(100 bases per row)
TACACACTTCGTGAGAATGCACAGCACGACAGTGGAAAGAAAGGACGGGATCAGATAAATGGTGCAGGATCTTACAAGCGGTTACTTACGGTGCCTACAT
CACTGTGTCAAGTACTTACACTCTGAGCTGGCGGATAGTGCAAGCACGCAGCACGCTGTTGCTCCATTTTCTCGCCAACTTGGCTATCATGCGCTTGTGT
TTTTGGATTTGTATGGACTAATATCTGCGTATTTCTTCTATGTTGTGGCATGTTACAGTTGCAGCAAAGCCCAGCCTCAAGTCTCTTACAACAGAAGGAA
GAACGGTACCAATGTCATTATTATAAACAAACGTTTTTGCATGAGAACGAGACAGTACTATCTGAAACCCTCTTTATCGTATGAACTTTCAAGAGGGTTA
CAGCTCCTGGTTCGTGAGGAATTTAGTGAGCATGTCGAGCGCGACTTGCGGCTGGTGCTGCGGCACCATGTGACCTGCGTTAAACACGCGTAAGAACGTC
AATCGCCGCTGGAACGAGCGCACGACCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTGTAGATCCGCTCCTGGGCAGCGTTGAAATCGG
TTTTACCATCCCACTCGAGTGCCTTGGTCCACGCCTGGTTCCCGTACCAATTACACGCCAAGTCGGCGTCTCCGGCATAGATCAGCACCCGAATGCCGTC
ATTCAGCATATCTGCAACGAACGAACTGTAGGAAAGCACGATATCGCCACTGAGCGTAAACGCCATGTTCACGTCCATATTCACCATCTCCCATGCCCCT
GCACGCTCGCTGACGTGGAGCAATTCGCGAACACTTTCACGGTTCAGGTACTTCTCAATATGGTCGGTTGGGATGCACAAGTTCGGTGGGTCTTTGTCGC
AATACTCGCGAATGTCGTACATGTTGCGGTTGGCTGCATTCATTGGCTCGTCCAAATTTGTCGTGCAAAACTCTTCAGCCTCTACCCAGAGCGAGAGGTT
TGACTGGCTCGCGCGCATCAAGCGCTCGCATTCTGGAGCAGCCGCTCGCATCGCGGCAAGTTGCGACGCGTTCACAAACGTGATGTTGTAGTCATTGTCC
ACCATATCGATGTAGTGAGGGGACTGGATGATGGGATCTGTGAGTCCGTTGCCAATTGCGATACCTTGCAGGTTGATGGCGTACTCGCTGTCCTTGGTCG
AATTCTCACTCTTATTCGCTTTCTTGTTGTGCTGCCAGATGGCATGCGCGGCCTCTGGGACGTAGTGTCCGCCGTAGCTTTCTCCCGTG