Description :
From Genome Similarity Track
Location :
Scaffold_114:88830- 93866
Sequence
5036 bases(100 bases per row)
TCGCCCGAGGAAGAGACCTCGTGGTGACGGGTACGGGCGGAGACGACTGACATAAAACATAGGATGCGTACGCATCCTGCGAGGCAACTCGATTGTGTAC
GCATTGCCTTTGCGACATAGTACATGGAATGGGCCGATGTACTTGGGTAGTAGTTTACTACTACCCACATTAGTTACTACGTGCTTAGGTAAATTTACCA
TAGACAGTAGAACTAAGTCTCCGACATTAAATAGAAGAACTTTTGCTCTTCCATGTTTATCAGCGTTCCGTTTCTGCCGGTACACCGCATTAGCGATGTA
GTCTTGCATGAAACGGACCACTGCTTCTCATTCCAAGAGAAAATCTTCTGCTGCATCACTTTGGTTTTTGCAGTGCGCCTTGTGCGCACCGCTAGAAGTC
ATCCTCTTCTTCAGCGAGGTGTTTTCATCCTCGCTGCTGTAGTCATTGGCGATGCTGAATATACCAGCGTCTTCATCCTCATCTGGGTCGCGAATAGTGT
CATCACTATTGATAAGGTTATGTTCTTCTATGTCGACTTGATCGACATCGGCAACGTTCGCGTCGTCGATTACCTCGACACGTGATGAGCAAGAGCCACA
ACGGTTTTCTGCTCGAGCGAATCCCCCCCTTAAATTTGTGTCATTATCTAATTGGGCGGGTAGGCGTGGATGGCGTAAGCCATTCATGAAAATGGTGTAT
GCGTTGTCGATGCATGCACGGAGTTGTTGATTGCAAACTCCATCATCGGCAAAAATTCGCTCCAATCTGTGAAAGATTGGACGTATCCTCGAAGTATCTC
TTCGAGGACGCGGTTGACGCGTTCTGTCTGACCATTATTATCGGGATGGTCAGAAGTAGACATATTCAGACTTGTTCCGAGGTATACACGGATTGCCAAA
ACGTTGCCGTAAACCGAGGATCTCTATCAGAGACTAGTTCACATAGTAGACCGTGGAGTCGGAATACTGTGTCAATGAAGACACGGGCACAACCATGTGC
TGAGATTGACTCATTAACTGCATCAAGATGTACCATCTTGCGGAATAGGTCTACGAACACAAGAATACCATTGTTCTTGTGAGCGTCTTCGGGGAAACCG
AAGATGAAGTTCATTCAAACGGACTGCCAGCACTCTGCCGGGATTGGTAGAGGCTGTAGTGGCGCACAGGATGAAAGACTGGGCTTCACCCGTTGACACA
CTTTACAAGCAGGAATGTATTTGCGCAAAAACTGAGACTGGCGGGGCCAGTAAAAGTCGCGACTTACCGTGAGATAAGTCTTCTCACGCTCACGATCCCC
ACTAGTTAGCGCATCGTGGCACTCATATATGATGCGTAAGGGCAAATGATTACGCGTGGGTACGATGACACGAGGTGTGTCGCTGGTAGCGGCTGTATAA
TACAGCAACCCGTTGCGTGTTGTGTATCGATCCGCGGAAGATCGATACAAGGCCCGTAAATCTTTGAGAGATTTGCGAGATGGAGTCACCAGATGATCCA
TTAGTCGCAGAAGAGCCTTATCTTCTGCGTAGGCCTTTTGATGTCGCCAAGCAATATTGACGACGGGACACTAGTGACTAGTGTTGCAATAGTGGTATCA
ACCTCACTGTTGGACTGCGCAGCCGACTCGATTTCGAGTCGGCTGCTCGTCGGCGCGACAACGCGTCCGCGACGACATTAAGTCGTCCGGGTATATACTC
CACGGAGAAGTTGTACTCCACGAATAAGGACAGCCACCTCGCCATCCTTTGCGGGAGGTGTGGTCTGTTTACGGCCGTGCATAATGACGCATGGTCCGTA
TAGACTACAAACGGCCTATCTCGAAGGAGATAGACGTACTTCACTAGTGCATACTTCATTGCAAGGAGTTCCTTGTCATGCACTGGATAATTACGCTCAG
CTGCTTGCATCTGACGCGATTGATAACAGACGACACTCTCTGCGCCGTCTGAATTGTACTGCATTAACGCGCAGCCGATTGCAAAATTGCTGGCGTCGCA
GACCACATGGAATGGTCCGTCTTGGTCTGTAATCGCCAAGATGGGCGATTGCATCAAGCTATGCTTGATACGTTCAAAGGAACGCTGACAATCAGCGTTC
CATGAACATTTCTCGTTCTTTTTCAAGAGACGAGAGAGATGAACGGTCATCTCAGCGTAGTTGCGCGAGTACTTGTGCAAGTACGCCGCTAGCCCAAGGA
ACTTTCTTAGTCCCTTAACGTCGACTGGCACAGGCCAGTCGGTAATCGCCTTGATCTTTTCAGTATCAGAGCGTACGCCGTGTTTACCCACGATGCACCC
AAGAAGTGGTGTTTCGCTAGCAGCGAATATGCACTTCTTGAGGTTGGCGCACAGCTTATGCTTGCGCATAAGTGTACGAACCTGACAAACGTGAGTTCTA
TGAACCTCTACGTTCGGCTTTCTACCCATAGCCCGGATATGTACGAACACATCGTCAAAGTAACTCGGTGCGAAGTCCCGCACCGGTCGTAACAGATTTG
TTACACATCTGTTGAACGTTGCAGGGGCGTTACTCAGCCCCTTTGGCATCAATAGCCACTCCCACAGCATACCGCTGGGGGTGCTCACTGCTGTGTACGG
AATGTCCCGTTCACGCATTAGGTTCTGATAGAAGCCATCCATCAGATCCATGGACGAAAAGATGATACTTTTTGACATACCATCAATGATTACGTCCTTT
CCTGGTATCGGCGTCTGAGCCGGTACCGTTGCAGCATTCAACTTGTTGAATACGTGCACTATCCGCCATCCTCCTGTGTCCTTGCGCACACAGAAGGTCG
GAGAGCTGTGAGGGGAAGTGGATTTCCTCATATGGCTCGCTGCAAAGCGATCGGCAAAGAACTTGTCAATCGCTAGTACTTGTTCACGAGGCAGTGGCCA
CTGATTCATGACACAGTACTTCGAGCCCGGTGTGAGATCGATATCGTGTCGAGTGCCTTTGTCCTTAGGCAACTCGCATGGCACGGATTCGGGGAACACG
TCCTTGAATTCGTTCAAATCCTTATATAAACGATTTGCCTGAAGCGACTCTCAAGATTGAGACCTGTATCTCTCAATCCGAGTCTTCTTATCGAGGACAC
TTTCGTCCATTGATAAGCTGCTGAGAACACGTTCGTTCTCTTCAAATAATACTGCCGACCGAATGTCAGTCACGTAATCTTCCTTCATGACGAGTACATA
GATCTTCTTGATCTTGCTACTACGCAGAACTCGCAAGAATCGTTTCGGTTCTACCGTTGGCAATTGAGTGATCTCCGAAGTCGACTTCGGAGGCACGATC
AGACCAAGCGTATAAGCGCCTACGCTTGATCCTTCATTGACCAATACATTCAATGTCTCGGTTTCTTCCTAGGAACTTGCTTCCTTAGGTTACTGAGAGC
CTGTTCTCTCAGCATGTAACTCTTGAGGAATCCTTTCCTCATGTACGTGGGGACTTATTTCTCTCGACGTCTTCTGACTGTGGATGTGCAACCACAGTCA
GATACCTATCCTCTACGGTCGACTCTCCAGTCGACCTAGGATGACCGTGTTGCCATTTGGTGGTAACCGATTTCTTTATTCTAGGAAGTTGCCCGCTAGG
CATGCATCCATGTTCCGGTCCACTCGACTTATTCGAGTGGTGTACCTTGGAGCTGCCTGTACTTCTGAACAGCTGCCGGGAGATTGCTCCACAGTGTAGA
AATCAGCTACACTGAGGTCTTGTGCAGTCGTGCTAACGACCGTACCGCAAGTGAGGCCATCGCACTCACTCGCAGTACATCCACACGCTTTGTGGACGCT
CCATGCCGTTCATCAGATGACTATCTGATGAACAAGCGGCAGGCATCTTCATGGATCGATGCTGCTAGCTCACTCTTGGCTTGTATCTTCTGAGCCAAGT
TAATCCCAGGATGACATCAAATTTGTCATCCAGATCCAGTACAATGAAATCGTTATCGTACTGTTCACCCTCTAACGTGTAGTGGATTCCAACTACACGT
TTCTCAACGGTTATCGACGCGCCTGTGGCAAGGCACACCGTCATCATCGTTTGAGGGATGTCGCGCTCAACGAACTTGAGCCTACGACCCTCTAGCGACT
GACGACGAACAAAGTTGTTCGACGCCCAACAGTCGACTAGAGAACGAAGTGACAAATCATTTGTCACTTTCAATTCCAAGGTGATGAGTGATACCTCATC
ACCAGGTGCAGAGACACACAATAATTGTGTATCTGGAGCAATGTTTTGTCAAGAGATTTGCAAATTCTCTTGAGTTTGCTGGATCAGTAGGGCGCTCCGC
CCCTGCTGACCCCGACCATTTTTTGATGGTCCACTTCGCTGTTGCGGTTTCGCAACAGCGTTAGACCTACGCTCATTGTCCTTTCTGGCAAATGGCCGAT
CATTTCGCTCTGTACTGTTTGGTACTGGGCGTGGGGCACTATACTCTTAAGCGTAGTGTCCCAACTTCTGGCAGCGGTTGCACTTCTGCAATCGCTTGTT
GTTCGAAGAGCGAGGTCTCTCTCTCTCTCGACATAACAAAGGTCCATTGGTTCTGGACCTCCAGTCTCTTGTCGTCTCGGTGGACGATAAGAACTCGAGC
TATCATGAGCATGTCTCATGCTAAAGTCCTCCTGTTACGCAGCTGATATTGCTTGTTCAAGCGTATCCAACTCTAAGCGGAACAGGTGGTTCCTGACGGG
CCCGTCTACGAGCCCTTGCATGAACACAGTAATCAACTTGTGTTCATGTACTGGGTTTGCAACTATAATAATCGCGAGGAGTCGTATATGTTGAGCGTAA
GCGTACACATCACGCTTACCCTGCTTGAGTTTCAGAAGCTCTGATCGAGCCTTGAACTCCGCTTCCAGCGACCCAAAAGCATATGGGTCGCTCATCTCCA
GCCCTAAGGCCCAAGTCTTGGCACGTCCCGCCAAGTGGGTTTGAGCAAATATGAGTTTTATTTGCTTATCGTCGATACGTCGTGCTTTTACGGCTCTGTC
TAGCTCGACAAACCATAACAACAGGGATTCTTCCTC