Description :
From Genome Similarity Track
Location :
Scaffold_54:88826- 90462
Transcript NameFunction/comments
Physo_137438hypothetical protein

Sequence
1636 bases(100 bases per row)
TCATCATACTTCGCGTTGCTGCTTTTGGTATGTTTTGAGTTCGAATTGACCGATGTCATCTGGAAGCTCATGCGGGTAGGGCGCACAATGCGGCCGCATG
CGGCCGCATTGTACAAAACTGTGCGATGCGGTGCGGCCGACCTGACGGCAGTTTTTACGAGGTTTTTCTGCTTGTCGTATTATATTGTGAATTCCGGCCA
AATTTGCCGAATCGGGTCGGTTTTGGGGCCCCTGTCCAACCGACCAATACAAACATCAAGTCATTTGCCGAATCGCCGGCCAACAAACATATGGTTCTGT
GCCCGCATGTCAAGCCCAATCCGTACTTAGTAGGGAGTCAAGGGGGCATAGCCGGGCGACCTTAGTCAACCCAAGTGCTTTGGCCACGGACGATTCAATC
CGCCCCGATCGGAAAATTAGAGTAGAACTCACAATAATACTGTGAAACATTCAAAAAGACAGCGATCTTTTAGCTTTTCTTTTTTGGCTGAAAAGCAAAA
TCTGCTGCTAACGTTGTCTTCATACTACCAGTATTAATAGTAGTGTAGACCATTTTCCAATTTGAAAGCGACTCTGCCCTCACTACTTCCGCACAGATGC
AGATAAACTGTCGAGAGCTTCCAGCACCAACCAAAGGCCGTGGAAAAAGGCCGCAAAATGTTTTTCAGAGCAAACTCACAAATGCTTCAGATTTTGAAGT
TCAGACGGCTTTGTCGGGGTTGGACACGACTCTTTCTCGGCTCGTGGTGATCTTGATGTACCTGATGCGCGTGCGGCCATGGTACGGGCCCCAGAGGGCC
TCCAAGCACTGGATGCGCTCACCAAGCTGCATCTTCATCGTTTGCGGGTAGCCGCCGTTGCCGCCGTGGTTCGCACTGGTTCGTCCCGCTCCCGGGGGCG
TAACTTCGATTCCAACGCCGTTCACGCGCTCGCCGGTGCGAATCGTGACGGAATGAATAGCCTCTCCGGACTTGGCAAACACCGTATCCGTGAAAAAATT
ACCGTGGGGCTCGCCATACGTCTTGCCGAGCCGATAAATCTCCCAGCCCTCGGTAGTTGCTTCAGTAGCGCCGATCGTCATTAGCGCCACCGTTGCCAGG
ACCTGGGAGAAGAACTTCATCGTTGTAGCTTGAGCTTGTTGCTGGAACGAGAGAAATTGAGAATGAACTGAAGCTCCCGCCGTCTTTCCCTTACGGCTTT
GAACTTGCCATTCACTCGATGGTACACCGATACGCATCCACCATGGAAGCATCCCAGATGCCGGATGTACTACAGGTACTCTAGGATAAAGGATAGGATC
GGCCTATTGGAAGGGGCCACTCACAGTCACGTTCCATGATGAAGTGGTATCGTTCGTCGACAAACCCACCGTAAAATAAGCGGAGGATTTTTGGGAGATC
TGGGCAATCTCAATGCTACACTTGGTCTCGATTCAACGTGATACCTGTCAAGTATAAAAAAATATATACTACGATTTTGGCCATCAAGCCACCTGTCTAA
CCATCAATGGAGTATCTGATAAAGCTAAACCGTGTGTATAAAAAAATTGAGGGCAGCTAAGGAAAACATGTTTACGAGGTGGTTGCTCAAAATCGCACTT
AATGTGACTTTGCCCATACTTGTACGAACAATATGG