Description :
From Genome Similarity Track
Location :
Scaffold_54:88825- 90444
Transcript NameFunction/comments
Physo_137438hypothetical protein

Sequence
1619 bases(100 bases per row)
CTCATCATACTTCGCGTTGCTGCTTTTGGTATGTTTTGAGTTCGAATTGACCGATGTCATCTGGAAGCTCATGCGGGTAGGGCGCACAATGCGGCCGCAT
GCGGCCGCATTGTACAAAACTGTGCGATGCGGTGCGGCCGACCTGACGGCAGTTTTTACGAGGTTTTTCTGCTTGTCGTATTATATTGTGAATTCCGGCC
AAATTTGCCGAATCGGGTCGGTTTTGGGGCCCCTGTCCAACCGACCAATACAAACATCAAGTCATTTGCCGAATCGCCGGCCAACAAACATATGGTTCTG
TGCCCGCATGTCAAGCCCAATCCGTACTTAGTAGGGAGTCAAGGGGGCATAGCCGGGCGACCTTAGTCAACCCAAGTGCTTTGGCCACGGACGATTCAAT
CCGCCCCGATCGGAAAATTAGAGTAGAACTCACAATAATACTGTGAAACATTCAAAAAGACAGCGATCTTTTAGCTTTTCTTTTTTGGCTGAAAAGCAAA
ATCTGCTGCTAACGTTGTCTTCATACTACCAGTATTAATAGTAGTGTAGACCATTTTCCAATTTGAAAGCGACTCTGCCCTCACTACTTCCGCACAGATG
CAGATAAACTGTCGAGAGCTTCCAGCACCAACCAAAGGCCGTGGAAAAAGGCCGCAAAATGTTTTTCAGAGCAAACTCACAAATGCTTCAGATTTTGAAG
TTCAGACGGCTTTGTCGGGGTTGGACACGACTCTTTCTCGGCTCGTGGTGATCTTGATGTACCTGATGCGCGTGCGGCCATGGTACGGGCCCCAGAGGGC
CTCCAAGCACTGGATGCGCTCACCAAGCTGCATCTTCATCGTTTGCGGGTAGCCGCCGTTGCCGCCGTGGTTCGCACTGGTTCGTCCCGCTCCCGGGGGC
GTAACTTCGATTCCAACGCCGTTCACGCGCTCGCCGGTGCGAATCGTGACGGAATGAATAGCCTCTCCGGACTTGGCAAACACCGTATCCGTGAAAAAAT
TACCGTGGGGCTCGCCATACGTCTTGCCGAGCCGATAAATCTCCCAGCCCTCGGTAGTTGCTTCAGTAGCGCCGATCGTCATTAGCGCCACCGTTGCCAG
GACCTGGGAGAAGAACTTCATCGTTGTAGCTTGAGCTTGTTGCTGGAACGAGAGAAATTGAGAATGAACTGAAGCTCCCGCCGTCTTTCCCTTACGGCTT
TGAACTTGCCATTCACTCGATGGTACACCGATACGCATCCACCATGGAAGCATCCCAGATGCCGGATGTACTACAGGTACTCTAGGATAAAGGATAGGAT
CGGCCTATTGGAAGGGGCCACTCACAGTCACGTTCCATGATGAAGTGGTATCGTTCGTCGACAAACCCACCGTAAAATAAGCGGAGGATTTTTGGGAGAT
CTGGGCAATCTCAATGCTACACTTGGTCTCGATTCAACGTGATACCTGTCAAGTATAAAAAAATATATACTACGATTTTGGCCATCAAGCCACCTGTCTA
ACCATCAATGGAGTATCTGATAAAGCTAAACCGTGTGTATAAAAAAATTGAGGGCAGCTAAGGAAAACATGTTTACGAGGTGGTTGCTCAAAATCGCACT
TAATGTGACTTTGCCCATA