Description :
From Genome Similarity Track
Location :
Scaffold_477:888- 4051
Sequence
3163 bases(100 bases per row)
AGCTTCTGTTAATCTGATGTGATGGGGACATTGGGATCGCCTATCTGAATGTCGTCGGTTGTTACCTCTGGTGTTGATGCCGATACTTCTTGCAGTCCCG
CCAAATGCTCCAACACATCCTCAGAAAACAGATCACTACTCTCATGATTATAATCTGGTGTCTCTGCAGTCTCGTGTTCCTCGATCTCTGACGGCAACGC
TTTATGTGGGGCTTTCTCCTGTTTTGCATAATTCGGTTTGACTCCTTCACCCGCCGGATTACCATCTATTTTTCACATTCATTTCCTGGTGGTTGGGGAT
TGGTCTCGCAATCTTGGTCCGTTGGCGGCCGGAGAATCTCGTCATGCGAGAATGGATCAGCAATATCGACCTGTTCTTTTTTTGAAACACCTTTGTCTTC
CTCGTACGATTTACCTTCAACATCCCGATGTATATTCATTGCGACTAATGGTGGCATGTCCTTTAGTCTGGCGGTCTGTCGTCGTATGGTCTACTTTAGA
AGTGACGTGTTCAAGATGGTCCACAAGTGGTCCAATCCACTCTTTAGGTGGGCCTTTCAGTCGATCCAACATAGTATCATATGCCAACGTGTGCTATTCT
TGACATCGGCGCGATCCTACTAAAAATAGCATTTTAGTTAGTGGTAGCATAGCGCCTTCAATCCATATGCCCAATATGACATGTGTGGGCAGAATGATAT
CATAACGGCTGATGTTTTTCATCTGCAAAGATGTCTTTCTGCCGGGTCCTGCAATCATCTTTGTTGCCCAATTCGGACCTTTCGTGACCCACAACTTGTC
GTTGGAATTCTTGATCCCGAATTTTACTTCTCCTGGAACTTTGGTCGGGATTGCTTCGATTTGATCTATCGATGTTATATTCTCTTTCTCCAAGTTATAT
GAGGAAGTCGTCCAGAGAGATGGATGCAAAGTTCATCTGGCAGACACAATGTACCGTCGGCCAGATCGAGACGTACCCCGGCGGGTATCATGTTGTCCAT
CCCCAAAATCGCTTTTTGTCCAGATTGGCCTCCCACCTAAATCGAAACAGTATACTAGCGATCCCGCGGGAGTAAACTTGATCTTGGTGCGTCCTGTCGT
AATGTAAGAGTTCTCGCCGGTCCTCATACCTTCTTGTCTAACTTTTGTCGATGACACAACCAACCTTACGAGCAACGGTGGTGTAAATGAGAGGGGCTTT
AGCACCAGATTCGGATAGCTCGGGTCGCTTTTACGTAATGGATCTTTCCAACAGTTTTCGCCTGCTTGTAATATTTCATAGGCGCGTCAAAATTTCAATA
TCCGTGCGATTCCCCACGAGCGAGTTCGAACTCCATCGTAGGTCCAGACCGCTGATAATCATCGATCATCCTCAAACTAGAGATGCTAGCAAAATGTTGT
GATCTTAAGTAAGATGTATTCAATTCCATATCTGATTGCTGCTTATTCTCACGACCCATCTGTACGTTTTCCACAAATGCGAAATTACAGAGCCTAGAAC
GCTCGGATTATAGCAAGTTCCAAACTGGCGAGCGTCCTAGTTTAACATCTTTTAGGACTTATCTGGCAACATACTTGCATGCTTTGTAATTACGTACCAC
TGGCGGACCATTTTGTAGAACCCCCCACCTATTACAATTGTGAAGGCCTCTAGACATCTTACTATACCTGATGTCGAAATGGGGTGTTCCACCTCATGCG
AGTACGATCCAGATGACCTGACCTTGAAGAATTACCGGCAAGGATGGCTAATGTCAAACTGCAACAGGCACCCAATGTGTTTCCCGGATAAACGCTTAGC
GACCTCAGAGCTCAAGCCGTTGGGAGGGATCAAGATAAGGACTGCCCACGCAGCTGCGTGGCTACAGTAACTACGGCATTCACGAGAGATCAAGCTCCAG
ACGGAGAAAAGTGCCTCTTTTTCGGGGGGGGGGGGGGGCTGTTGACCAGACCAGCGCAGATCTGGAACCTCTAACTAGGTCTTTCCGGTCAAAACCAATT
GCTAGGTCTTATTGCAAGAATTAAACATGAAGTCTGCGGCTTGGGAGTACATGTTTCTTGCCAGTACAACTATTTTAAGAATAGGTCGTACTAATCCCCT
TGAACTATCTATACCGTATAAATGAGATTGGACTCAGGCTGAATGTAAAGATTGAAGATAAATCGTTCAAGATTTAAAAAGAACATGTCGAGCACTATAT
TAAGACTTTGGACGATCCAGAGCTAGCGGACCAGTTGAATATTCTACCTATGGCGGTCGTGTAGTAACTAGAGGACTTGCTGAGCGCGCGTCAACGGACG
AATGAACGATGAGGCAAGACATTAATTTGGATCAAGAAAATTTCGGCAGAAGGCACCTTCACCACCTGACCGACCAACAGAGATGCACCGCCGCTCCGTG
CATGCTGTTCGGACGTACCCTGATAAATCAAGCTTTGAGGAATCCAACATGGAAATATCATACAAAAAGGAGGATTAAGGCGATTCGATCTGATGGAAGC
AAATGCAGAGAAGTATCCAGGTGTGAGGACTTTGACGGAACTATCTGTCAAGGAGGTCAACCATCATCGCTGTCGGGTAAGGGAACCGATACCCCGTAGT
TCTTCGGTCTCTCTTAACACGAGATGCGCCCACTGTGGGTCTAGGAAGCATGCATACATGGGATTTTGGAAGCGAATGACCTGTGGTGACTGCTGTGTAA
AGAAGGGCCACCCATCGGATAGCAGTTTTTTCTGTGTCGCGGTTTTGGGGAGATTTATAAAGTCCGGAAGTGCCCGATAGCAGAGTTTTTCAGCTTTATT
TGCCAATGGTAAAACCCGACCACGCACGTTAAAATATTGCCGGAGAAGTTCTTAACGATATAAAAGTTAATCGCTCGCCAGATTTGAATCCGATACGAGC
CGAGCATTCTAATTTATGCGTATATGCGGGTGTGGAAAAGCAGACCAAGAATGATATGGGTGCACCTTATAAGACGATTGAAAATGTATCAAAGATTGGA
GCTACCCTATGGTCCATGTTGCTCCTATTAAATGAGCCTATTAAGTCTGCTCTAGAAAACGCAGCGATTGAGTTAAATTTATTATCTGGCGAGTTTAAGG
GATTGGAATAATTCTACTTACTAGTTAAAACAATCCAAAGCCTCTGGAAAGGTCAATAGAAAT