Description :
From Genome Similarity Track
Location :
Scaffold_3245:888- 2602
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3245-snap-gene-0.2Tau-tubulin kinase

Sequence
1714 bases(100 bases per row)
CGGCGAGGTGCGGTTGCCCTTTTGATGCCGCGGCGGAAACGCGCCACCGTTGGCTCACCATTTTGTTGGATCCAATGGGAACAGGGCACATTCAGTCAGA
TCTACTCGGCATTCTGCGTCGACGGCGACGACAAAGTGGCCATCAAGGTCGAGGCACCGAGCGCGCTCAAGCCCGTGCTCGAGTGGGAAAGCACCATCCT
TAAAAGCCTCCAGAAGTGCCCGTACGTCTGCCGGTATTACTACCACGGGTACGTTCTGTATGCTTGATATTCCTGCGGCTGGCAAGAGTTAATCTTCCTA
TGATTTTATTGTGGACAGCAAGCATGCCGAGAGTACAGTGCTCGTGATGGAGCTCTTGGGCGAGAGCATGTCGATGCTGCGCGTGTCGCCCGAGTCGATC
CACGGCGTGCCCGTGTCCAAGTGCGTGGGTGTGGGCATTGAAATGCTGGACGCCATCGAGGCCTTCCACCGCCACGGCTATGTGCACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAGGCCTCCAACTTTGCTCTCAGCGCGCTCAAGGCCGGCATGCCTTCGGTGCGGCGCCGATACTTGCTCA
TTGATTTCGGGCTGTCGCGCCAGCATTTGACCGACGGCACCGTGATTCCGGCGCGACCGGTGGCCGAGTTTCGAGGCACATCGATGTATGCGTCGCTGAG
TGCCCACCGCCGCCAAGAGCTCGGTCCAAAGGATGATCTGTGGTCGTGGTATTATCTCGTGCTCGACTTTATGCGAGGAGAACTGCCGTGGGCGACCGAC
GCACAACAAAAGAATCGCCAGACCGTGTTTACGCTCAAGGAATACTACACAGAGAAACGGCCAGGCCTGCTCGTCGAGGGACTTCCAGGCGGGAGCCACT
TGCTGGCCATCATGAAGTACTTGCAGGGTCTCAAGTACGAAGATACACCAGACTATAGCCTGCTCCGTGACCGGCTTCGACGCGTGGCGGCCGGCACCGA
GGGTGAAGACACTATCGAATTGTGGGATGCATTAGGATCAGACCGCGAGCGGGCGTTGCAGTGGACTGAGCGGGCCAATGACGCGCTGCAGAAGAATGCC
GACAACAACGTTTTGGAGACACTCCAGTCGGTACGTATTTTCAAAGTGATCTCGGGGATGAGATTTACGAATCGTTACTGATCTGGTGGCATTTTGCACT
TTTGCAGGTGGCCAAAAAGTACGACACATTTTTCGACTGCGACGAGCTGAACGAAGACGAACACATGGCCGTGCAAGAAGCTGTATTTGAGTTGGAGACG
AAACTGAAGGCGAGTGTGCAGAAGTTCGCGCCGCCTCCGATTCAGAGCTTCAAGCGCCGTCAAGAATCAGAGCAAAAAATTCGCACCGACGCGCTGCGCA
AGCGACGAGAACGAGATATGCAGATTCGCCACAATATCGAGCAAAAGCTGCGTCGCGAGTCAAGCCGATTGTCGGTTGGTTCACCAGCCAACGATATGGG
AAATGGGAACGCGACACCCACCAAGTTTGTTGCGAACGCGGTGGCGTCTCAGGCGCCTCCTGTCCACAAGTCGGAGGACTCGTCCATGGATTTGTCCGAC
AATGAAGAAACTCCGAAGGTGGTTATACCACCACCGATGCCCTCTCAAGTCGTCTCGGCGCCAGCGATGCCCAGCCCTGTGCCGCCTCGTGGACCTCCTC
CGCCGCCTCGACCG