Description :
From Genome Similarity Track
Location :
scaffold_775:8879- 14014
Transcript NameFunction/comments
Pl_102472inositol-3,4-bisphosphate 4-phosphatase, putative

Sequence
5135 bases(100 bases per row)
CACATCAACCTATTGCCGGTGTAAATCTACGGAATGCCAGAACGAGTATCCTGGCGAATCTAGTGGCTCTACTTGCGAAAGCAAGCTTTCCGATGGGTCA
TGCCCGTCAGGATACAAAACTTGTGTGTCGACGGATTCCTACAAGGTCTCGACATCCACGGTCACTCCTAGCAGTGTAGCAGAAGCGACTTTCACGCTTT
TGGCTGCCGATATCATCGGAGCATTCTACAACTTGGGTGAGGAAGATCCAACTACCCGGAAAAGCAACTGGTGGATCACAATTTCGCTTCCTAGTGGATG
GAGATTTGTCGCGTGGGAAAACACTGCAGTTGAAGTGACGCTGCGCGACGATGACGGAGATCATCCATCGGCCGTACGCGTGCACAGCTGTGCTGACGTG
ACAAACAGCAAAAACTGTGACAGCGATACTCACCGATATGGTTTTGTCGACGTCATGGATCTGCTCGAAGGTCGAGAGGATTTAATGACATCGAACTCAG
GGAGCCCAATGTCTTTTGTCCTCTCTAAAAGTATCGTTACAGGCATCAATCCATCCAGCAGTTCGGTGGGTGTGAGTGTGTCGCTATCTTACGAGACATC
ATCTGGAACGCTCAAGTCTGCCGCGACGTCCAGGCGCACGCGGGAGTTAACAGTGACTGCTACTGACTCAACTACCTCAGTCGAAGATTTGAGCGCCCTA
ACTCTCGCCACAATGGCGTTGCCCTCTGTCCGAAGAGGTCGTTTGGAATCGTCGCTGGTGTGGATGGAAGAAGACACCGAAATCATGATGCTGTCATTTT
CGACGTCAACAATTGTTGGGCCAAACTCAGACAGCCCAAAGGTATGCGTTGACTTACGTTCCTCATACTGCGCAAGCAAAGGGCGTGAGCCGACGTCTAC
TGTGAGTTTTGGATCTTCCGCGCAAGCTTCATACGTTCAAGGTGGAAACCCGTTCCTCAACCTCTACGCTGACCCAGGTGATACCAACTTGAATATCGTG
AGTGATAACACCACTTACTTCTGCGTGACGGACCTCCTCCCTTCGGGTGTCAAAACAAACGACTCATGGGAGATCAGGACGTCCTTCACCTTCCAGATTC
AGGTAACTAACGTTGCCTGGACTGGAAATGAGAATAACGAGAATGACTACACAAGCGGATTCCGTTTACCTCCCCTCAGCGAGGTTATTCTGATGGACGA
CAGCGACGTGATGGGGAACGATTGCGCGCAGACGTTGGCACACGCGAAGACATGTACGTACTTGTTCATTTTGCCACTCGCGCCCGAATATGTGCGCTGA
TGGTCATATCGTAATGCTCTGGTACAGATTCCAAGTACACATTAAGTGTGTACAGCGTGATGTCAATCACGTTCTTCGCTGTTGCTCTGGCTGGCGCTGT
TCTCGTTACACGGATGGTGAGCTTCCTAAATTTTCGTCTGATATGATTCCTAACTAACGTGTTTACGCTGTTAACAGAATGGTATCTCTTTCTCGAGACC
AACGTTTTACAACGACATGACATCATTGTCTGTTATGATGATTTTCGTATTGTGTATCGTTGGGAACGCGATTTGGATTAGCGTGTCGACAAATGCGTCC
TCAGCCAGCGGAACCGACATCTACTACCTGTTGTATGCCATTTCTGTCTGTTTCACATGGACAATGATGACTTCGGTGTGTTTTCACTGGGGCACTGTGC
TATTCCACGATGTGGGACCCTCTGGGCGCTTATTCGTGTTCACGATCTATGTGATCATCAACGTGGCGTTCTATGCCACTCAGCTTTTTGGAGTTGTCAG
CCTCACAGATTTCTACAAGTGCACATACGATGATTACCTCAAGAACCCATTCTACACCATGCGACTGTGCTCAAATGACTACTGCCCTGATTTACAGCCT
ACGCAGTGGAAATATGCGGTGAACAATGTCTGCAAAGATGTCAGCTACTCGGACTGGTTCTTCCCGCTCCAGCAGAGTGCCGAGTTATTAATCTTCCTCA
CGTCGGTGGCATTGCTTGTGCTCGGTACGTTCGTGATCCAGCGCGGTGTGCGGCTGATCGATCAGTCTGGTGACATCTTCGATGATCATGTGGTGAAAAT
CATGAGGAAGTCGCTGATCACGTACTTAGTTGTGATCTTATCGATTGCACTTGTGCTTGGAACATCCTGCATCATGAACTCCATTCTCCATTGGAAGAAC
TGGAGCATCAACTCCGTCGTGTGGTATGTTTTTTCTATTTGGCTACCGACTTTGGTCCCACCGATTGGTTTTTTGCTGCTACAATGGAATCCGCGTCTCC
ATGGTATGAATTGGAACCCGTCATTGCACGTCAAGGACCCACAGTTGCTGCACCGAACAATGTCAAGCATATCTGAGAAGGTTGAAAGTGGCAAATTCGA
CATTTCTGGAAATGGCACGGGGTTAAGCGATGGCTGGGCAGGCATTTTGCGCTTTCCTGATACGGAATATAACCCGATTGGACAGGAGAGTGTCGATGGC
ACGCAGAATGTACTTGCACTAGCAATCCAGCTGGTATCGCCCATTCCTCTTACGCACGCATGCTTCGTTGAGCTCTACGTCGCGGAAAACACTGCCCCTG
AAGCGGGTGAAAACGATGTTACTGGGGAAGATTACTACGAAGATCTTCCAGTCCTGAGCTACCGCCGTTCTTCGATCAGCACATTTATCGAAAGTGGATT
GCACCAAGAAGGAATTCTTAGTCGTCGCAGTCATTCACTGTCAATGCTTGGTCCCGGGGCTCTACCAACGCCCGTACTGGTGTCTAACCCAGCAGCAAAG
TGGTCGCGCGTAGGCTTTACAGAGACTGTTCTACCAACGTTGGTGGCTGGCAACTCGGAAAATGGCAGCGGAGTAACGCAAATCGCTACGTTCTTGTCGG
TACTGCAGATTCCGGTGATGCCTGCGAACCCGCTTCTTCGTTTCGTTGTATACGAAATCCCGGAGAAGGCGTCGTCGCCGTCGCCTGACGGTGACTTGCG
CGAGTCTCGTCAAATGATGCGTGCATCTTCCCGACAACTCGATGAACGTGCAAGAATCGCTCGAGTGTCCGGCATGGGTATGGCGCCACCTTCGCGGCCT
AAGGTGTTCTGCGAATTCTCGTGTGCGTGCGATGACATGCTTGCGGCAGATGAAGTGAATTTGGTGGCACGACAGGTGTCATACCGCAATCGATCGCCTA
TTTCGACAGTCCTCAGTGATGGAACAGGCACAGAATCTCCGAATGTTGCGGCTGCTATCGGAGCTGCTACCATTGAAGTGGATCCCTCGGTTCCTCGTCT
GCGAGTCAAGTCTATGACGGTCTCTCCACGCCAATTGAAGGAAAACTCCGGGTTCTACATTACTAAAAGCTTCCAGTTCGCTGAAGGTGACGAAATGGTG
ATTGAAGACATGGCTGAAAGTCCACTTACAAACGAGTTACCCCGGCAGTACTTGGAGCTGCTCGTTTCCGAAAGGTCTGACGATCTTGCACATACTCAGG
CTGATGCTGCGGGCTTTGAGGCGAGAGTGAAGAGTGGACTGGTCGGTAATCTGTACGACAACTTGATTGAGCAGATCCAAGGTGAGAATGACCAGACAGT
GGTGCAAACGTGGCTGAATGAACGTGTCCAGAAGCGCAAGATGTACGTCGAAGCACTGCGAGAGTGTCATCAGTTGTGCATCGAACGTGCGGAGGAAGGA
CTAAATTTCAAGGCTAGTACGGAGAAGAAGAGTCTTGTATTGCGCTTCCTGCCCATTAACCTGCATGTGCAAGATATGTGGGTTGGTCCAACAGCCGATC
TACGCTCTCAGCGATCAAGACGGACGTCACCAAACGTTAGGGTGTATCCTACCGTAACGGTGGGGGCATTTGCAGCACACTGCTTCAAATTCCGTCACAA
TGGCAGCATTCTCAGTTTGCGTTCGACATTGCAAAAGCGATCCTTGTCAAAAGTACAGAGTGACGTGTCGGACAAGAGTAACGTCGATATGGTGGACTGG
ACCAACGTGGCCACACGCTCGACGGACGAAACGCGATGGCATCTCACGACGCGGTTCGACATGTGCTTTTCGCAAGCGCTGACAACTTTGGTCACATCCT
TTTGTCGCCAGTTGGAATACTCGCTGCAACATCCGACGGACAGAACATTCTTGAACACGGTCTCCTCGATCGGCTTCCTATTCCAGGTTGAGTCGCTGCT
GTCTACCCAGGGCAAGGAAATCGGAATGCTCGAGGACTTCTCCGCAGCTGTCGACGCGCTCAAGCACGTCACGTTTGTATTGGATACCTCACCACCGGCG
CACCTGCCTTCCACTCTGCTTAACTTGCACATGAAGAACACGACGCTTCCTAGCGTTGTGTCTGTGCGCTTGAGTAAGGGGTCTACCAAGGGGACATTCA
CTGTAGCGATCGGTGTGCGTTGCTCAGAAGATGTGCAGGCCTCAATCCCATCCATCATTCGATCGGGTGGCTCGATTTCCGTCACTCCAGTGATCTTCAC
GCAGGGCATCAATGAGATGCAGACTCTGGCAAACAACGCCAGCAGCAGGAAGACGACTCTGCAAGATATCATCAACCGCAAGAGCTTCTTCGTCTTGACT
CGCTACGTCGAGAAGTACAAGCAACTGGCAACACAAAGGGTACGTTGCTCGAGGAGTTTAGTGTAGGTTCTGGTTCATTGTTTACTAACTTTTGTTTGGT
TTTGTTCTACAGCCGGACGCAGTGCCGACGCCAATGAGCAAGATCACGCCTCTCTTGGAATCGCTAGAGGAGCGTATCGCCACTGCCAGTAAACGGCAAG
TGGTGAAATCGAAGCACCCGAAGATAATTCAGGAGAGCTCTCACTTGTGCCGACTGCTTGGTGCTGGTCGCGTGACGTCGTGCAAAAGCGCCAAAGACCG
CACGAGCATGTCCGTGACGCTTGAACAGGTTCGGCTGCTAAGCGAGAACCACGGTCTACCGGAAGAATTCGCAGTGCGTACGGTATCTACCATGCGCAGC
AACGGAGTTCGCCTGGAGAACGCTCTCAAGAATACCGGCAAGCGCCAGTATGCCTTCAACGCGTTGCAGCGCTCGCTACTCCCGGACGAATACAAGTGTC
CCGAGGGCACATATGGCCGTGGAAACGTAAGTTAG