Description :
From Genome Similarity Track
Location :
Scaffold_84:88785- 91903
Transcript NameFunction/comments
Hyaar_Emoy2808614transglutaminase elicitor M81C

Sequence
3118 bases(100 bases per row)
GCCCCGCCCGAAGTGACAGGTGATAAGCGAAAACCCGGCGGGTGTTCAATGACGACCTTTAGCTAATGTTATCTACTTTAACACTCGCAAAGACATCTCC
TGGATGGAATTCGAAGCCAAATCGAATCAAATAATTCATACAGTTGATAAGAAAGGGATTGCAGGAGATGTATCCCTTTATCGGTTCAACGATTTTACCC
AACCTCGCCCGATCGGTACACAAGAAATGCAATACAGAAATAACTGTTTGATCTGAAAAAAGGCTTTACTTCTGGATGCGCCTGCGTCGTTGTGAGTGGT
GTCCACCATAACACGAGCAACAGATTTGTATGCTTGACGTCGCGATTCTGCCTCTCATGCTGTCCGACCTGAAAGCGGGGTAAATAACCATCTCTCCGTA
CGTTTGTGGGGCCTTTCGAGCATATGTATGTCTCCGTAAGTCCATCCAGTAGATCAGAGTATATGGTAAAAGATATAGCAGCAGACACCAAATTGACTTG
TAGTTGATTTGCAGCTGATACTGAGAGGCTATCCGTCGCAAACCGCTGACGGAAGGTTCCGTGCAGTGTATCACATTATATCTCGTTCCTTCGATTAAGA
TACGAGATATAAACGCAGCTACTCACGCGATTAGCGGGAAATGACTGACTATTAAATGGTTCAAGGGTCACAATATCGTTGACTCAATCCCCGTCGTTTG
TCGCTCGTTGTCTGTCCCAACTGGTACGACAATAAAAGGTTCATGTAGTAGCTAGTTTCTACCATATATGATGGATTGAGTCGTGCGGATAGAGTATCAC
GTGGCATCACAGTAGCTTAGTCAAGCTAGGTTTGGATGATAGTCCATCGCCTACGAACGGGCGATCCTAGAGAGCGTGGCACGCTTCCTTGAATTTCGGC
CTTCTTTCGTCTGGTTTAGCTCGTCGTAGTGAGCCTTAACGTTTTCCTTTAATGGTGCAATCGGTAGGTCCACACGCCACCTTCCATGTGCCACAACCAG
CAGGTAGCTATCTTCCAACGACTTAGTCGTACACAGGGCGTCCGGCTTCAACTACCGATAATTCGCTAGTCTAGCGAGCTGGACGAAGGTCATTCCCCAA
TTTTCTCGCTTCCGAGAGAATTACTCGACTCTCGTCTTCCCACTCCTATAGCATGGTCTATGCGGTGCATCGCCACCTCCTCTTGGCAGCTGTAGCTCTT
GCCGCTGTACAGTTAGAGCAGGCTATGGCCACGTCTCTCGATTACGACCCCGTAACGTCAGCCAACACGACGAACGAGATCAGCAGCAAATTTCCAGGTC
GGGGAGCTGAAGTGAGCGACGACGACTGCTCCATATCTGTCGAGGTGGACCCGACACTACCTGATATCTCTACCATCCTCAAAGTTCCCGTGATGTACAC
GGACCTACTGGCCAACATGACGACGGCTCCAATGGAGTGTGTATCTTCAAAGATCGGCACGGCCGTCTTGTCTGAGGCCCTTCCGGCCACCGAAGCTGAT
CAAGATGCGTACACTACCACTATCTCGGGGTTCAATGTACCGTCCAAGACGGGTATCACAACCGCAGCTTCAGCCACCCCAACACCAATCACCGACGTTG
AGACTTCTGAAGACGAGCTGAACTGTGCCACCGGTTGGACTAACTCGAGCCGCAAACTACAGGATACAAGCGAGACCAAGCGGCGCCTGGAAGCTACTAC
GAACGAGGACATTGCGAGACTTGAGGCCTATTTTGGCACGTCGATGGAAATGAAGCTGGCCAATCTGCCGACTGTGGGTGTCTTAACACCGTCACCGTGG
CCTGGTCCGTACTGGCCAATGTTTCAAGACAGCATCAATGTCATCTGGAGCCCTGGCCAGCCAAGTGCTGCTGAGAAATACGCGAAAGCGTTTGGATTGA
ACGTCCGTGACTTTATGGACAAAGTCTCGGCCGACAACGGTGTCGACTCTATGCACCAGCGCCCCAAGTGTTCGTCGGACGACGGCTGTTCGTCTCGTTC
CGATGGAAGTGTGTGCGGGAAACGTGCGGGAAAGAGCTCTGGGTACTGCATCCCGACTTGGTTCGGGATCTGCCACGCCTGGGCACCAGCTGCTACAATT
GAAGAGGAACCGCGGTGTGCTGTGACACACAACGGCGTGACGTTCCAGCCGCTGGACATCAAAGCTTTGATCACGAACGTCTACGATGGCGCGTCGGTGC
CCGTTGTCTTTACTGGTGCGAGGTACAATGGCGGTCACGACTCCGAGGACGCGTACGGTCGTCACTCGAATGACGCCTACCGTGACCTCAATCCTGCCTT
CTTCCACATTGCTGCTGCCAATATCTTGGGAAAACTTAACCGCACGTTCGTCGCTGATGTAACGGCTGGGACGGAAGTGTGGAACCAGCCCGTGCGTGGT
TTCAAAGTGTATGAGCAGACTAAGATATCGGTAAAAGAGGCTGCTCGGATGTTTTACGGCCTTGAGAAGTACCCGTGGAACGCTGCGGCCAAGAGCATTG
TGTACATTAAGATGCGTCTGTCCTGGATCTTCGAGACGTACGACGACGGTGGTCTAGTGTCCTCTGGTCAGGTCAACAAGTACACTTCGGGTGCGTACTA
CACGTATCTGCTTGAGCTGAACAACAACGGGAAGATCATTGGTGGCGAGTGGGTCTACGAATCAGACAGCACCCACCCGGACTTCCTTTGGCTCCCGAAG
TCGAAGCCAGCTCTTGACACTGTGACTAGCGTGGGGCTGAAATACGCTGACGTGAGCATGCTTCTGGAGAAATCGGTGGCTTGCTCCGGTTCTCGTTCGG
GTTCTGGGTCTGGCGAATAGGCCGAGTCTCTGTCGATCGGCGAATACTGGCACCATTAATGCGGCCTAGTAAGCTACCTGTATGTTTGGTTCATCGGTGT
CTGACTTGGTCTTTTATTCAGCATCTGCTTCGACCTCGAGTTCATATTCAGATGAAGTACCAACGGAATTGAGCACGGTGTCTCCATGTCAGGACTGTCG
CTCTTCACCAAGAAGGCAGCTATGTCATGAAATCAATGCGATTATAGTTGAGGAGGTTACAAGGGGGTACCGCCGTTAATGAGGACAAAGTGTGACCTAG
AAGTTTTTTCAGTAGTAA