Description :
From Genome Similarity Track
Location :
Scaffold_133:88765- 92291
Sequence
3526 bases(100 bases per row)
CGCTCTGTAGTCACTTCAAACGCTAACGCTGTCCAATCTGTATACCGTCGTGATCCAACCAAAACGAATCCCGGTGGTCGAGGTATCATGTCAGATTCTA
TCCACAATAACCAGTGAAGTTTCATGACCTATAATTATATCGCGATCGCTGAGGCTCATAAACTGTAAATACTTGATCTGGCCAGGCCCACTAGTCACTG
TCGGCACACACGCCACGTCTCACCTCATCCAAAGTTTGGCCTTATGTGGACCAGCCCCAATACGTATTTCCGTCGATTTGCCCACCGGAATGACCACGTG
TTGATCATTCACGCTGATCACCTGCAGGGCTAATCGATAAGGTGGCTTCCGTCCTGCCAAACCAATTCGCACCTCGTCTGGTAGACATAATTTTTGTCGG
CTAGATCCAGACGAATGCCTGCCGGAACCATGAAATCCATACCCAATCTGGCTTCTTGGCCGACTTGATCACCGACCCAAACATCGAAATTATACACCAA
CGACCCGTCCAATTTAATCTTGGTCTTCTTCCGCCCCACCGTCATATATATATATGCATTTCCTCCAATTCCGACGCACTCTTAGTTTGACTTTCGTCGA
TCACACATCATACCTTACGAGCAAAGGTAGTATCGAGGATCGACACGTCAGCGCCATTGTCGAACAGCATAGTTACATTCTCATTATGATCTTGCCCACC
GCTTTTGCTTGCTTGAACCATTTTCCGAAAGTGTGGTATTTCCAATACCCGCGTGATTCCCTTGGTGCGAGGTCGAGCTCCATCCTCACAGGCGATCGGG
CGTAATCGTTCACTCTTTCCACACTTGATATTGATGAGACCAATGTAGAATCATTATGTATATTAGCGATCGGATCGATCCGATCGTTAATCTCTTGATC
CTCCCGTTGTCCTTCAACAAATGCATAAATGCAAAGCCTAGAATGCTCGTCTCGGGTCAGATTCCAACCTGGCGAGCGTCCTAGTTTAAAATCTCCTTCA
TCATGGGCGGAAACATCCCAGAATGCTTCGTGGGCACGTAACATTTTCGGCTCAAATTGAAAAATGCTTTCATAGGGCATTTGCTACTCTCGTGTATTTG
TCCGCATGCTGCACTCACAAAGAAACATATGTCAGAGGGGAGTCCTTTGTGACCATAATTTTTGTACGTCAATCTCTTCCAGCACCCTCGATCATTGTGT
CTGGTAGATCTACAATGGATACATGTCTTCGATCGTCCACCATGATCGTGTCTATCCCTTTCACCATTGTTCTTCTGCCAGGCGCGGTGATCCTTGTCCA
ATTTTTCTCGGTCAGGTGTAGTAGTCACGCAAACTCGACAATGATTCACGTCCTCACCGGATCCAATTGACATCGATTCCTATCCGCTCTTTTAGACTTT
CTCGCGGATCGCTCGCACCGCCCGAGCTGTATTCGACGACATCGGATTTGAAGACGTGGTCGTTCGCTGATGGAATTTGATCGATCTAATCGACGCTTTT
ACTGGCGATTATTCATCGGTTGGCACGCACGTAGGGTTTTCTCCACCTCGTCAACATCCATCAATCGCAGAAGTGTCAGCTGTTTTTCCAGATTACGATC
ATCCAGCGTAGCAATGAAGTATTCCACATGTTCGTGACGTGTGGTCAAGGTAGCCAATATTTCTTCTTTGATCACTATCTTGGCGTGCTTTGATGCGACA
TTGAGAAGATGAAGATAATTCAGCGGGGTTTCATCTGATCGCTTCCGTGCGAGACAATATTGCCTAGCCACAGACACCCCTTTCCCTCATAATGAACCAT
AAAACAATTCAGCGATTGTTTCCACTTTTGCCGTGTAGATCGACTCAGTTGGTTGTACCAATTATGTGCTGGCCCTGTCAACAGATCGACGAACACCAAA
CACTTTTTTCGTCAGGCGCCTAATCGCGCAGGAACGCCGACTTGACCTTGCTGATCCAGCTTCTGGCCCGATCTTCATCTCTGTCCTTGCCACTTAATTC
TTTCAGCTCCGTCATTGCTGACACATGAATACGCTGGGGAATTCTACCACGATTCGGCAACGTTTCTGCAGCGGATACCAACTCAAGTCTCCGCTCTCTT
TGCCCCGAATCATCGAGAACGGCATCGTCATGATCAAGAATGTCCAATCGACTGAGATGCGATCGGACCCATTCCATCTCGACCTTCGGGGTATATGCTT
CTTGAGATATTAGAGATATTGATCCTTTGGCTAGGGTAGATCACTTGATAAGCTCTCTCCCATTGTTCTTGTTGAAAACGTTCCATGGCCTCTTCGAGGT
ACGCCTGCATGTGTCCTTGCGTAGTCAAATTCTTCTCTTCTTTTGCACGTGCGGTCGTCGATCGTGGTTCGATCCTAATCGTTTCAACCTGATTACGCAG
ATGTGCCGCCCCACTTGGGCCTAGAGACATCCGCTGAATACCGATCGAAACATCGGAATCGAATTCAGATTCAGCTGACGCGTACAGCAACTATCCAGTG
TATTATCCTCTCGGGGCGTCTACGATCGCTGCGTCCGCTTGATCCTTCGGATCACACTTACCCGTTAGGGGAATTAACTTGTCGATTAGCGATCAATCCG
CATGGTCACCTGATCTTCGTCGTACTCCAAAATTTTGTTGGCGTTGAATACTCCAGCGACACTACAAGCGTCATGTAGCTGCCGTATGATCCCGTTGATC
TCTTCCAGCATTTTAGACGCTACCGCCGGTAAGGGTATCGGATTTTGGATCCCTCCTATCAGCTTGGGCTTCAGAATCCGGAGCACTGGGTCACTTGATA
AAGATTATTGAGTATCTTACAGTAGTATCCCTCCGCCAACTGATCCAGCTGCTAACCTTCCATCTGTTTCTATTATCGACCACGAACTTTATCGGTCGAT
TGATAGACTTCAAGCTTCGATCGTGGTGCTCCGACCTGGGCGCTTCTTTCTTCACTCGTGCTGTCTTCACGTTCTACGTCTTTGACTTCCCTTGAGTGGT
ATTGGCGGATAATTGTTTGATTTTAACCGAAGGGTTTTCACCCAGCATATCGTGTTTTATGGCATGATCCGCGGTGGACCCCGAAGAAACCTCAGGAAGG
GGTAGAGGTTTCTCTTCCGGATCGATCGATCGATCTTCCTCTTTAATTTTCTTATCTTCCGAGCCCCTCCCAAAACTCCAATAATCTAAGGATCCTTTAA
ATTAACGCGTCTGCGGCGATCCCTCTGCATCTGACACTTCCATCCCAGGATCCTTTATTACTTCACCTATGCAATCCGGGACTCACGGTAAAATCCCGAG
TCACCAGAAAATCCTAAAACACTCACCATTGTAGTGTAGTGGCGATCGCTCATTTTATGAGGCGAACCCAACTCTCCACTGGTGCCCAGACGACCGACTA
TCGGAGGGGGTACTCCGTTTCCATGCCTTGTATTTCCTTCCTCAACTTGTGTACCCGTCAGTAGGGCGGGCTTCACTCTTCTCGGTGGACTCGTGTCGAG
GGAAAACTTGACCGTGTTGGGGATGG