Description :
From Genome Similarity Track
Location :
Scaffold_67:88738- 91162
Transcript NameFunction/comments
Phyra_52281diadenosine tetraphosphate hydrolase
Phyra_96206Hypothetical protein

Sequence
2424 bases(100 bases per row)
CTCTCGTTCTTGAAGTTGAAGAAATGTTTGGCGTGCATCTCGGCTCGGTGGGGATCCCTAGAGACAGAAGGTTACCTTCTCGAGCAAATGGAGCGGAGAG
CTGGTGTAAACCATGATACGTAGTTAGGAGATAGGCTTTTTGAGAATGAGGTCTACTCGCTTACGAAACAACGCTCGTCGCCAGTCATCTCTGTTCGCTG
GCAGCTCATGTAGATAGGTAAGGCACTCACTCAGCATGGAAACACGCGTGATGTAGCCACGTTTGTAGCATATCGTAAGGGAAGATTGCTGGGTGATCTC
TTTATCCGACAGGGAGTTCACTTCCCCAGCTTGATACGGAGGTACCTCCCGGTTAGTGCTTGGGCTTGCACCAGAATCGGAAGCTCTTCATTTAATCGGA
TATGAAGCTTTTTCATAAGAACAACCCCGGATAGTTAGTTGGCGGTCGGTTCGTTATAGGATGTTCCTCTGCTCTCACAATACAGCCAAGCAATTGCGCG
CGTCAGCACCAGCGCTGCAGAAGACTGAAATACCACTACATGTAGCAAGTTTAGAGGAAGAGAGGACGCAGTTGGGCGGCCTCTGCGGCCATTTCCGCGT
CGGAGCGAGCTGTCCGCGTTTCGTTGTCGACGAGCAGATCCTGCTCGTGCTTTTCGATCTGCGTCGTCAAAGCAACTTAGTAGTAGCGGTTGATGGAGGT
GTAAAGCGATGGCATACGGTACCTCCGTGTAGATGTCATCGTTGTACTCAAAGTCGTGGACGACACGCGGGATCACGTGGATGTGCACGTGCTGCACAGT
TTGGCCCGCCGCCTTGCCGTCCTGCAGAGACCATGTTAGTGAGCCTCGCTGTGAGGGGCTGTGAGTTTAAGGTCTGTCACACCTGAATAGCAAACGTGAG
AGAAGACGCGCTGTGATACCGCTCCACTTTCTTACCCACCAGCTATAAAATACGCATCCGAAGTAAAAGCAATCAGACCAGTGCAAATGGCAATTCGAAT
GGGAGGGGTACATGTAGTACCTGAGCGGTGGTCCACAGGTCGCTCACTTCGTCCACATCCAGCATCTCAAATCGCGCCACGGGTCGCTTCGGCACAATGA
GCACGTGACCTGATGGTGTTTGTATCCGCAAGACGTGAGCACCACTGTCCATGCAACAACAGCATTGCCGTCCGCACAAACCTGGCACAATCGGCTTCAA
GTTCACCAGCGCAAAAGACAGCGCAGATTCAAAGAAAACTTGGGAATTTTGCACACGAAAGGGGCCGAAGCAGCGGCCAGCAGGATCGAGACACTGGTCA
AAGTTCAGCAAGTCTGACAGGGATAATATGGTGAGTAGGTCTCGAACACCGAGTACACTTCACCATCGACTCACCTTTCGTAAACTGTGCAAGAATTGAT
TCAGCATCATCTGATTGCAAGGGCAGAACCACTAAAATAGCGCCACTATCCACGCCGCCCGTCAGCGTCGGCTCGGTCACCAGCAGCGTCTGATCCAGTG
GAACCTTCAGCTCTCTCGACGCACTTTCATACATTGATGTACCGTTCTGGTACGAGACGCACTAAGCTAAGAAACACAGCATACGGTGAAGTGACAAGCA
TTTCGTGCCAACCAACCTTCTTGTCTGCATGTACGACGTGGAACGCGCTCAGCACACTGGGGCCGCTCGAGCTTGCGTCGCCAATAAACCCCAATCGGTA
GCCATGCCTGGCAATTGTACAGCCCACAAAATATTGTTTTCTGCTCACAAAATCACTTGGCTTCGGCCATAATTCGCGAGCTCTTACGTCTTGAGCGCCC
GCACTGCCTGCAGAAGCCAAAGCGCACGATTGTGTCATTCCGTGAGACTGGTGCCCTGGCACAACCTTCGACACTTACATTCTCCACTTCCGGCTCCGCT
GCAAACGTGCACTTCGTCGCCGACGGACTTAGGTGGAACAGGATCGAGCGCACGTTGCGCTCCGCCACCACGCGATGCACCGCGCTCTTGCCAACCTGCA
GAACAGTCATGTGCTGCGTTTTGGTCCAGGTCGGATCTAAAATTTAGTCCTCGGCAAATATTATACGGCCGTGTAGCAACTTGTGCTAACGCAACATAGA
TCTTATGCAACTTAATTAACGTTGCAGGAACACCATTCTCGCAGCCGCTCGTTTGCTTCATATCCACATGCAGATGCTGCGCCAGGTCTCGCGGACTCGT
GCGGCCGTGCGCGCCGCTGCGGGCCAGCCCCGCCGCGCATTCAGCGTTCCAGCCAAGGGTTCAGCGGCGCCCAAAACGGTGCCGGCCGTCACCGCCAAGC
CTGCGAGCAAGCCCGTGACGTCTGCGCCGTCGCCTCCCAAGTCGGCGGCTGCTGACTCGTCCACAGGCTCGTCGCTGCCCAAGCTGCTGCTGCTAGGCCT
GCTGTCTACGCCCGCGGCCACTGC