Description :
From Genome Similarity Track
Location :
scaffold_168:8873- 23028
Transcript NameFunction/comments
g4976.t1hypothetical protein
g4977.t1 conserved hypothetical protein
g4978.t1hypothetical protein

Sequence
14155 bases(100 bases per row)
CGTCGTTTTGGCAATCGCACAGTGCGCTTCCCACTGCAACAAGTCGGAAAGAAGCACAGTTCTACGGTTGCATGTGAAGACGTTGAAGGCGTCGACGCGA
CGGATTAAAACGCACAACACGTATCATAGTGGCCAAACTCGGCCCTGGAACTTCCAGGCTGGAAGTCCGGCAGCAAGACGTCGGTGAACTTGTCCTACGA
ACGGGCGTACATCAAATCTACCGAGATCATAAGGAGAAGCAAGGACGACCAGCTGACCCGGCACTCACAGCGGCTGTCAAGGCCGAGGATCGCGGCAGCG
CGACGTCCCACAGTTTGCTCGCGTCAGCAGCGCCGCGCGGCGCAAAGTCCATGCGGCAGATGGGAACCACGTTGAATCAAAGTGATGTGGCGGCGAGAGA
CGCCCGAGTACCTGCCTCACTCTCGAAGTAGCGAGCAAAGGCTCTGAATCCGCGCCATTGCCGAGGAAGACGCCGCAGCCTCAGCTGGCGGTCACTAGAC
AAGCTACAACAAAGAGACGTCGATGCTACGGCACTCGGCCACGTCGACGCCGTCCTTTTCGGACTCGAACTCCTCCTGCCGGTACGTCCGAATACTGAAC
GCGAACGCATCCGGTCCGCGTCCGACGTAGCATTGGAAGCTTTAGGTTCATTCACTGACGTTTGTTTCCTCCTCGTTCTAGCGATCCTGGCGTCGATATG
CACGACAATGGCGGCCACTTCCCGCTTCCGGACGATTATTTCCCGGACATTCACCTAACGAGCAAGGAGATCAAGAGCTATGAGGCTCAGATGCAAGAAA
TCGTCAAGAACGCACTAGCGGAGTACGAACTGCACGAGGCCAAAGGGATGTACCCCGTCTACCGTGCGCCGTGGAGTCTCGTCAGCAAGGTGGAAGGGCT
CACGACCATCAAGAAGGAGACACCCGACAGCCCCACGGCCAGCCAGGCACGTATCTTCGGCCGCATCAACGGCGACTACCGCCACTTTATCGACTTCTTC
TATGCCGAAACATCGGCCGAACTCTTTGCCTGGAACCAGTTCATGTTTGGATACGCTACGGATGCGGCCGTGCTCAAGAACATTCACACGGTGGCGTCCA
AGAAGAAGTGTCTGTATATGGGCATTAAGTGGACGTGTCTAAACCCGTCGCCGCTCGTCAAGAAGCGCGACAACTGCTACATGGAGTACATGATCTACAC
GAAGGACCTGCGTGGACGCGACGTTGGCGTGCGCGTCACGCTTCCGCTTGACATCCCCGAGTGCCCCGACCTCCCAAAGAAACTCAAGACCAAGCGCATC
CGACTGAACACCGTTTGGATCTCCCGACCTGCAGACCACGAACCAAACGTGACCGAATTCTTCATGCTGTCCCAGAACAACTTCAACGGCCTGGCCGTCA
CGGTCAACTACTACAAGCGCATGATGAATATTCTCATGAACATGGCGGTGTTTGTCGACTCGCGACGCATCCTCATGCAGGGCGTGATGCAACGCAAGAG
CTGGGCCAAGTCCCGCTCGCGCAAAAGCTGCAGCGTGTGCGAGCGGAAGTTCGGACCGACGCGCCGTCGCCACCACTGCCGTCTGTGCGGAGATCTCATT
TGCCGGCGGTGCGCCATCGTGCGTGACGCGCCGAAGGAGGATGACGGAGACGCGTCGGCCCCAAACAGGACGTTCGAGATCGTCAAAACCAAGTTCTGCG
TGCTCTGCGTGACAAAGATGCGGGAATCCCGCAACAACGTGCTCGTGCCGGTGCCCGCGCCCAGCGGTAAACTCTCTGTCGTTGACTGCGACTGTGGGGA
TTTGGATCTGGGCGAGTCCCGCCACTCTACGATCTCCGAGACGGAGTCGGAAGGTGGACACATTTCATTCTTCTCCGAGACGGGGAGCAGCGAAGGAGCT
CGATCACTGCAGATGTCACCGCGATCTACGTCGATCTCCTCGAGTATTGGCAAGGTCTCTTTCGTATCGACGCTCGACGTGATCGACGATCAATCGGTGA
CGATTCTGGCAGATCCCAGAATGACCACCAGCGAGCTGATTGAAGAAGAAGTGGCGGAGGTCATTGACACGATCGATATGGTGCCGGTATCTTCACTTCG
GGGCGAGGTCTCGTCAAACGAAAGCTCAGGTAAAACGAGCTCGGGAAGCGGCTCCAATTGGTCTCCGCTTGGTTCCAAGACCTCCCCGCGCTCGCTGGAC
CAGTGCCTTGCCGAACAGGAGGAATTGTTGCGTCGCATGATGCTCTCGGCCAGCGGCATGCGCCAACAGAACAACGTGAACCCAGGGAGCGGGTGCGGTT
ACTCCGGTGGCGTCCAATCGACTAGGTCTCGGCCCGATGTTACACTCTATGAAGGCTAAGCTACACACGCAGTCCTGTCTGCAAGGAGCACAAAAGTATA
AACCTAAGCGTAAGTAAAAGTTGTTGGAACGTGTTTGTTGCCTAGAACCTCTTGTCGAGTGGTCTCCTTAGGATCGAGTTCGAGATAGGTCGGACCTCCG
ACCGCTAAACTCGTTCCGTGCCTGACCTCAAGCTCGAGTTCGAGCTTCAATGGTCTGGTCTGCCCTTCAAAGCTTACTTGGGCATCCTTCTAATTTATTA
TAGAAGCTCTGAAGTCCGCGTGGATTCTTCGAGTCCCAACGTCGTACGACCGTGTTTGGATTTCCAAGTTGGAAATTCCAACGCAATCCGAACATTGCAT
CCTCTGCGTTTTGCAGCCAAAACGATGATGCATCGGCCGGGGTTCTTGGCCACGGTGCGGCACCACGAAGAAGCCATTTGATCCTAAACTTCAGCGAGTG
CAGCACTGCAGGAAGCCAAGCGATCCGATCCACACAAACTGGTGAACCGGCTTGAGTGAATGGGGTTAGCCGGTTCCTAGTCTTCAAGGTCGCTGATAAC
TGAACTTGGTCGCTGTATGAAGTTTCTGAGACGCGCTTGGCGGATCGAGCCCCACGATCCTTCGATCGAACGAGCTGCCTCCACCAAACAGCATACGTAG
GCTCATTCGTCGTCTCCTCAGCGCCGTCCAATCGACAGAAATCCATACAAACCGGCTCATTTCAGCAGCGCCGCCCCCCCTCTGCAACAGCATAATCAGC
CCGTCATCGCGAAAAAATCACGCCTCTGCGCTGCACAAGCGGCAGTGTGAGTGCCCCGGTATCGCAGCCGTATCGGATGGAGTGCATTTGCCCGTTGCCA
CCAACACTTTCTAACTTGCCAGGCCGTGTTGAGTCGCGCGCGTCGTTCGTTCGGTCCGCCTTACCAAGAGTGGCAGTGGCTTAAAAGCCCCACGACCAAA
CAACAAGATTTTTTCCACTGTACGCAGCGTTGCACTCTTCAATCGACGCCATGCCCCTCAGGTCGTCGCCTTCGCTGCCGCGCACGGCCTCCGTGAGCTC
CAATGCTTCCTCGTAAGTCGCTTTTTCCAGCTGCTTTCGTTCCTGAAGTTTGTAACGGCCAAACGGTTGTGGAGACTTTCGGTGCTCGTTCCGACACTAA
CGATCCTTGCTGCTGCAGATATCGAGCTGGCAAGCTCCAGTTTCCCCTTCCAGATGACTATTTCCCTCCGGTGAGCCTCTCACTGGCGCAGGTGCAGCAG
TACCAAGCTCAGGTGGAGGATATGGCCGCCAAAGCCTTGGAGTCTTGCAGGGACCACGAGAACCGGGTCGCCGGCTTCGGCCTGGAGGAAAGACGCTGGC
AGGACGTCGCACAGGACACGGATCTGTCCATCGTGCGTCGCAAACAGGGGCCGATCACTATTACGCGCACGTTCGGCACGGTCACAGGCGATTTCCGCCG
ATTCGCGGACTTCTTCTCGTCTGAGACGTCCGAACAGCTTTTCGCCTGGAACCAGTTCTTCTTCGGCTGCGCGGTTGACGCCGTTGTGCTGTGCAATCTG
GACCTGGACAAGTCGGACACGCAGGCTACGCTTGGTATTAAGTGGACCTGTATGCAGCCGTCAGTGCTCACGCGGAAGCGCGACGAGTGCTTTCTCGAGT
ACATCGTGTTTAGGAAGGACGACCAGGGCCGCGACGCCGCTGTTATTGTGCGCATGCCTGTAGATATCCCCGAGTGTCCGCCTATGCCGTACGAGCTGAA
GACAAAGCGTGAAAAGATCACGACCGTCATGGTTGTACGGCAATCGGACATGAGCCCGAACGCGACGCAGGTTTTCATGCTGAGCAAGTGCGATCACAAG
GGGCTCACGGCTTCCACTAAGTACTGCAAGAAACTGTTGAAGGCGCTGAAGGACGTGTCTCTCTCAGCTGACGCCAAGCGCATCGCCACGACTATTAGTG
CGCCAGGTTTCGTTGAGCAGTCACGCGTCGGAGGCGAAGCTTCAGCTGGAGCAGACATCCGACCGTGGGTGCCCACGGGCGTCCAGCACGGCTGCACGAG
CTGTTCGCGCCCCTTTCGAGCTGGCCACAGACGCCGCCATTGCCAGATGTGCGGCGACGTGTTCTGCTCCAAGTGCCTGGTTCGACGCGCCGGCATTCGG
CAGGACAAGAACCCGTTTAGCAACTACATCACGACGACGAACCAGCGGACGTTCCGAGTGGTGCAGTCGCTATTCTGCAGGGTTTGTGTCTCGCGATCCC
GTGAGGAGGACGCGGAAACGATTCAAGAGCAGGTGGAGGCAACGCGCCGCTCGGTGGCGTCTTCCAAGGCGTCTTCCGTACCTCATCGATCGTCGGTGGG
ATCGTCGACGCAGCCGCAAAGCTCCAAGTGCTCGACGCCGACATCTTCGGTGCCGCGCAGCCCCCAGTCGCAACAGGCCGACGCTCCTCGTCGCAGTGCA
ACGTGGAGTGAGGAGAACCGCGCGTCGTGGTGGTCGGAAAACGAGTCCGAAACGTGCAGTTGGAAGTCTGGATCGAGTCGATTCAGCACCATCTCGCGCA
ACTACAGCGGCGCCCCCACTGTGCGCTCGTCACTCAGTTCCGAGTACTCTTTGGGTAGGAACTCCTTCTTGGCCGTGCAGTCTCTGGAGACCCCGCGTGA
GATCGACACAGACCGTGCGGATGATCGAATCGACGAACGCTCCAGTATCTACGAGGTGATCGACACCAAGGACATGTTGCCCGAGTCCGAGCTTCAGAAG
CAGCTGCGAAGCCAGCAGTTCGAGACGGACTCGGCCGATGACGACTACTTTAACGAGTTCTCCGACACCACCCGCGCTCGCTACACGTCGACACCCGTGG
CTCCGACGTTCTTGCCGCCCCGTTCAACCGTCAGGCGCACACGCAGTACGGACCAGAGCGAGAACACCGCCGCTTCCAAGTCGCTGGACCAGTGCATCGC
CGAGCAGAACGAACTGCTGCAGCAGGTGCTGTCTGCCAGCCGCGGCTTCAACCCCGACGTGAAGACGCCGTCGTCTGTGCCCCAGCAGAGCATTCTCGAA
GACGTCGACGAGAGCCACGACGATGGCGTTTATGAGCTGTAACTCCGTCTAGTGTAGACGGAGGCATCCGCCGCGAAGACAGCGGGGATAGTAAAACGAA
ACCACTCAGCAAGCTATGAGCAGAGTACACACATTTAATAAAACTTGAAATGGCACAACTTGATGGATCACTAGCGAACGGTGCCGCTACTTTTGTAGAG
TGACAGCACTTCGAGGATAACCACAGTGCCTCATCGCTTCCACGAGTCAAGTTGGCTGTCAAGAGCGTGGATTCGCTTGGCAAACCGGGTATGAGTGCCC
CGTGCGTTTGTGTGGCGAAGTGATGAGGCATGCAGACGTCTCGCTTGCTTGCACTGCTCAATGGTAAAGTCCACTCAGTCCGCCAGGGAGGTCGACGCCG
CATCTCGCAAGAAACGTCCGGCAGGTTGACTCCAAAATGCCTCTCGTCCGTGTCCCCATCTGGTAATGTTCACATCACCACCTGCGTGCGAGGCCAACAC
TTCCGCTTGAGGCTTGGCAGCATCCCCTCATTATTCGACGGCCCCTGCGTCCGCCACGGACTCAATTCAGTCGTACGGATTTCTGGAGCTAAAGTATATA
CAAGTCTTGTCGGTCAATAACGTGGTGGTTTGTGCGGCTACAGGTCCAATATGTTTGCTGCCCGTGCCAGCAAGGAGAACGCGTTCCCCGTCCCCGACGA
CTTCTTCCCGGATGTCCAGCTATCGGCGCTCCAAGTCTTCGAGCTCGAGGAGAAGATGAAACTCGCGGTAAAGAACGCGCTGGCCGACTACGACGTGCAC
GAAGCAATGGGCCCCACTCCGAGCTACGGTGCCGGCTGGAAGACGCTGGGCAAGGTCGGAGACCTCGTGACCGTCCGACAGAACGGCGACGCCGCCGTCT
GCCAGTGCCGCATCTTCGGTCGAATCGGCGGGGACTACCGCAACTTCCTCAACTTCTTCTATGCCGAGACGTCCAGCCAGCTCTTTGCCTGGAACCAATT
CATGTACGGCAACGCCGTGGACGCCGCCATCTTAAAGAACATCCACACGAGCTCATCGGGCAAGCCGCACCTGTATCTGGGCATCAAATGGACCTGTCTG
CAGCCGTTCGCACTCGTCAAGAAGCGCGATACGTGCTTCCTCGAGTACATGGCCTTCACGAAAGACTTGAGGGGACGAGACGTGGGCGTGCGCGTGAATA
TGCCGCTTACCCTACCCGAATGCCCGCCTCTACCTGACAAAATGAAGACGAAACGGATGGAAATGCTGATCGTCTCCATCGTTCGCCCTACGGAAGGAGA
CCCGCACTCGACCGAGCTGTTCCTCATGAGTCAAAATAACTTTGCGGGATTTGCCGTCCCCGGGTTCTACTTCAAGCGGCTTATGACCAAGATGAACGAC
ATGTCCATCTGGGTCGACTCGAAGCTCATCTCGATCCACGGCATGATGAAGCGCAATTGCTGGGTCGACAAGAAGTCCCGGTTGGAGTGCAGCTTGTGCG
CGCGCGATTTCTCCACGACGCGCCGTCGTCAACACTGTCGGCTGTGCGGCGAAGTCTTCTGCCGGCAGTGTTTGATCTACCGCGGCGCCCGGGCGGGCGA
CGGGGACGGCGACAGCTCTCAGAAGACGTTCACGGTGGTGCAGACCAAGTTCTGCCGCGTGTGTGTGGCGAAGGTGCGGGATTTGGACGCGACGTTGCTG
GCGCCGGGGACGCACGACAAGACAGAGGCGGATCTGAGCATGTTCGCAGACTCCGGAGCGTCAACGAAGCTGGACGGTGAGTCTGCGGATTATAGTGACG
AGGACCTGCGTGCCTTGCGTCGATCTTCATCCAATTCTGAACTACTTGAGACGATCCGATCGTCCGGCGATGATGGTGTTGTAGATGACGAGCAGGACGA
AGTGCGCCGGAAAACCATGGGCGTTGACATGTCGAACCTCATGTCTGCGTCTCAAATGATGCGCCGGATCAACGCTGGAGCGTCCTTCGACCAAGACAAC
CAGCAGATTGACAGCTCGGGCAAAGTAGTATCGACACGCACCATTGACCAGTGCATCGCCGAGCAGGAGGACCTCCTCAGGAGATTGCTGCTCGCGGCCC
AGGACCAATCCCAGCCCTAATTAACGCCGTCGAGCGACGACAACGAGGCGAGAGCACCAACATCGAAATTTATTGCAACGTCCGCACGATGAAGCGCCTT
GGATAGCCGTCACGCACTCACGCGATCGCCATTCGTGCCTCTCATCGAGGAAGGCGAAGTGTGCATGAAGCTGCGCTGGCTTAGATTCCCCCTTACAGAG
TACTTATGAAGTATCAATTGTTGTTTTAGAGGAAATCACTGCTCGTTGGTGCCGAGCACCATTTGCTTGACGTAGCGTCGGACCGGAACGTCCTCCATTC
ATTCACCGTCCATTTCGCGTCGCGCTCCAGTGTCCTGGTGCTGACAAACTCGATTAGAGAGCTTCGACACGCGCCGGGGCGGAACTCACAATCGACGCGC
CGAATAATCCAACGTCGGCGATCGCAGGATAGATCGAGTTGAAGCTTTGCATGAGGCTTCAACACAGTAAACTTTGAGGATGTTTTCCAACGACAGCTAC
CTGAGCTCAACGTATTTGGTGCAATCTCTTTTCTTGAGAATAACTCGACATTTAATGGCAATACACTCGAAAGTCCTAACACTACGTGTGATGTACGTGA
CTATCTTACAACAGCCATCGTTAGTTGTTTTAGTTCGGGCATAGCTCGAACGCTTACTGCTGACTACGGGCGCTTGGCGGGTAGTATCCGGCGGACGAGT
TCGCCGCCATCACCAGCCGCTTCAGAAGTACCTCCTGCTCCTGAAGACGCTGGTCGATAGATACGTTTGATCGTGCTGAGCTGAATAGGTCAGCCAGTGC
ATTCGCGTCCATAGGCGACTCATCCAACGGGGACGAGACGATCTGCCGTGTAGTGGAAACAATTTGGTTCGGCTCGTCAATAATCTCGATGACGTCGGCT
TCATCGTCATCATCCTCCTCCATCGGCGGGAGTTTGCCGCTCCTGTTGCTTGAGAACCCGTCGATTGATCCATTGTCCGCGTTCGACGGGGAATCCACGA
GGCGAATCGCTTTGAAATCCAGCGCTGCCAGTGACTCCCGCATCGTACGAAGTTCTTCTTCCTCAGCCTCTTGGACGACACGCTCAGCCCCTGCAAGTGT
ACGAAGGTGGCGTAGATCAATCATCATGGGAGCAACAGGCTCCGTGACTTCAACTTCGATCTCGTCGTCTAGTGAAGACGACACACTGGTTTTCGTTTCG
GACTGCACTTCCAAGTCGATGCTAGAGATTTTGTCTTGCGGTAGACTGGTGCTTTGAATGGAGACTCCTTCCTCCTCCGATTCCTCCGCGTTGCTCTCTT
GCGGTGGAGCAGAGCGAGCAGAGCTAACATCAGCAGGTGAAAGCGATGCAATCGACCCGTCTGCAACCGCCACGCTGTTGTGTTCGTTGTCAGAGCTTCG
ACAACCGGATTTGTCCGGGAACCAGCCCGTAGATTCAGCGTCGGACGCGCCTTCATCTTGGCTGTCCGTAGCTGAGATCGCCTTGACCTCAGAACCTCGG
ACCTTCCCCATGCAGGCCTTGCAGAACATGGTCTTCACCACCTGGAACGTGCGTGACGTCGAAGAAGCGTTGTCATCAACCATCGGGGCGTCGCGAATGA
TCATGCATCGTCGACAAGCCACTTCGCCGCATAGACGGCAGTGCTGGCGGCGTCGCGTCGTTGAGAACTTGCGGCTACACACGGTGCAGTTCGCGCGCGC
CTTCTTCGACGCCCAGCTACGGCGATCCAGCATACCCTGCATCGAAATCCGCTTGGAATCGGCGAACAGCGCCATGGAGCTCAATGTGGTCATGAGCTTT
TTGAATGTAGCGACCGACGATGAGTTGGAGCCCTTGTACATGTCGACCTCGCTGGTCATGAAGATCTGCGTGGTGTCGGCCGTGTCGTTTGTCGGACGGA
CGATCGTCACCGTGTGCGAGTGAATCCGCCGGGTCTTCATCTTGTCCGGTAACGGCGGACATTCGTCGAGAAGCAGCGGCAGTGTGATGCGGACTCCGAC
TTCGCGGCCCTGGAGGTCCTTTGTGTAGACGAGATACTCGAGGAAACACATATCGCGCTTGCGAGAGAGCGTCGACGGATGCAGACAGACCCACTTCATC
CCCAAGTACTGGTGGGGCTTGTTTGATTCTTTCGTGTGGATGTTGCACAGCACCGCGGCGTCCACGGCGTATCCGAACATGAACTGGTTCACCGCGAAGA
CCTGCTGCGATGTCTCGGCGTAGTAGAAGTCGATAAAGTTGTGGTAGTCGCCGTCGACGCGGCCGAAGATTCGCGACGCCTCGACGGCCCTGGACGGGTC
CACCTCGCGGATGGCAGTGAGGTGTTCGACGTTGCCTACAACGGTCCATCGGGATCCGTAGTCAGGTCGAGCGCCCATTGCCTCGTGCAGGTTGTACTCT
GCCAGCGCGTTCTTCATGATGATCTCGACGCGCTGCTCGTACACTTCGATCTCGGCCGGGGTGAGCTTCACCGGGGGAAAGTATCCGTCCGGTAGTGGGA
ACTTGACATTGCTGGCGTTCATATTCGGTGTTGCGCCACTGCTCGCCATGTACTAGGAGGCAGCACTTAGCAAGCTACTACTTGGCGTTTGGCGGGGGTG
TACGACGCACCTAACACCAAACGTTCCTTTTGCAGTGTGGCGGGGCACAGATCACAGACAGACTCGTGCTGAGTGCTGTGCGCGATTGTGCTGGCCCGTC
CACCGTGTGCAATGCTGCAACACTGCAATGCCGTCGCCTTCCTTGCGACTTGACTTGCCAATGGCAACTTGCCGCTGTCTGCGCCTTTCGCGACGGGGCT
CCTCTATGCATGTATGTGGAGGAGACCAGACATCCGGTTTCGTGGCGCCGGAGAAGCGAATGGAGAGATTTGCGCGTCGAAGGCACAAGGGCGGAAAGGC
TCGAGGCCGCCTTTGGTCGCGCTGATCGACTGGGAGTCGAGACTTCAGGCTGCGTACGGCTCTGCAGGCCTTAGTCGCGCATGGAGCTCGACACCGGTCT
TGGTAGTGACAGGATTCCGTCCAGAGAACTGGTTCTCCATCAACCACGACTGTAGCAGTGTATTATCACGCGCATGCTGGCTCTGGCTGCAATGAACGCG
AGGAATTAGCCTGCGGTGAGCAGAACTTGAAACGATGCGCCTAATAATGGCCTTCCTGCTTGTAGATATACGACTCTAACTTGGCCACTTGGCGGTACAG
TACGGTGCATTCTTTCGAGGTGGCCAACCACTTCAATGTCCGCTTGGTGTTAAACGCGTTGCGTTTGAAATGGCTCTGGGGCGTAACATACGGCATGGAG
CTGTGCTCATTTTTCAGCAAGACGGCGCTCGGCAAACCTGCAGAGTCTGCAGTGCAGACCGTCTGCCAGACGCGCCAAGCCGAAATGATGGCACCGCCGT
CGTCGCGGAACTTCCGCAGCGAGAGAGCACACATCGATGGCTTGCCACGCCACCGAAGCTGGTGCGGGCAAGGAGCGACCGTCTATCTGCCAAACGACAT
TTGGACCTTGCTTGAGAGCAAACGCGGCATGTTCAGCGACGCCATCAGAAGCTGACATAGCCAAATTTGCCACGCGCTGGGATGCTTGAAGCGGGCCCCT
GGGCCCAGGCCGAGCTTTGTGGTGTCAGTGTCATGGTGTACTGTACTGTATCGATAGTTTCCACCAGAGACTCCATTGTTTCCACCAGAGACTGACCGCC
TCGAGGGACTTGCGCCAGTGATCGCAGTTCGTTCTCGTCTTGACTTCTCGTCGTCGTAACCGCATCTCGACGCCTCCTCACTCAAAGCGCTGGACTTGAA
GTGCTCTTTCGCCCATGGGCTCGTTGTTCTCTCCTCTTCAACGGTTCCTCATCGCTTTCGTTGCAAACATCGCATCTTTTACGGGGGTTAGCGAGATATG
TGGCGGCGCTTTGCCTCGGCCACAAACACCGGCACAAACACAGTCCACCCCGGACTGTATCACCGAATGCTTAGTAATTTTGTGCCTGCAAATGTGGGAC
TGCAACACAAGTGCCGAGATGGCAACAGCTCGCCAAGCTCGCCTCGCTGTCAACCACGAGCGATGGATCTCTATACGAGCTGGCTCGCCGCGAAAAAACA
CGAATGATCCGTGTGCAATGCTGGCCACCGTGATTGTCGCCTCAAGCATGACAACGATTCCCGCATGCATTGAATCGCTTGCGTGTTGAGCACGCCAGCA
CGGCGTGAAGGAGTGCTACAGCCCGCCAACCCATGAACTTCATGGTGAAGCCAATGGCGCGAGTGGTGACCGCCTGCATTGCGAGGTCCGATCCGAAAAC
CAGCCTGAGCAACTCAACATTTTGCTTCGTCCGACGCATCAATGCCCGCACGTGACCAAGACTCTTGGTCACCAGCCCTCGAGGTCGAAGAGCGCTTGAC
GCCGACGAGTGGCTGCTCCGGCTACGTGCGTAGTGTGTAAGTCACGACACGCTGCCGCGACTCTTCTGAAGCACATCGCTGGCAAAATGTCCCCAGCTGG
ACCTACACGCATCCGTCTCTCGGTGTGAAGTGGCGGCCTTGCAGCTCTTGGAAGGGATCTCGAAAGACTCGCTCGAGATTAGTTTAGTTCTCGATTTTCC
GCGATGCTGTCTTCGAGGCGTAGTCGCACCTTATCTCGGTACGTTCGACTGGCAGGAACGTTGACTCACGGGCTCCGATAAACTAACCACGGTTTCACTT
CAACAGGAACGACGCCAAGACGTTCCCATTGCCCGATGACTTCTTTCCGGAGGTCAAACTCACGGACGAACAGGTTCTGAGGTTCGAGAAACAGGTCGAG
AAAATCGTTCGCAACGCGTTGGCGGAGTACGAGCGACACGAGGCCAAAGGCGCCTACCCGATCTACAGCGCGCCGTGGGTGCCTGTGGGCTCCGAAGGCC
CGTTAACCGCCATTCGAAAGGAGACGCCTGCAGGACTCTCGCACAGTGAGTTCCGCCTGTACGGGAGCATTCAAGGCAACTACCGGAATGTCATGGATTT
CTACTACGCTGAGACGTCACAGGAACTCTTTGAGTGGAACCAGTTCATGTACGGCTACGCGGTGGACGCGGTTGTGCTTAAGAATATCCACACCAGAAGC
TCAGAGAAGGCTCACGAGTACATGGGCATCAAGTGGACGTGTCTTCAGCCGTCGGCGTTTGGACGCAAGCGTGACAACTGCTTTCTGGAATACTTAACGT
ATACCAAGGACGAGCTCGGTCGCAACGTGGGTGTTCGCGTAACTCTACCGGTGGAGATCGAGGAGTGCCCGGACCTATACCGGTCGCTGAGAATCAAGCG
CGTCAAGACGCACAACGTTCTCATCGCCCGCCCTGCCGGTTCCTCTTCAGACTCGACTCAGCTCTTCATGATGAGCGAAAATGACTTCGCCGGCTTGCCG
GTGAGTGCCAAGAATTTCAAAAAGTTCATGCGAATCTACAACGACATGTCGCTCTTCGTGGATTCCAAGCACATTTTGAAGCGGGGCATGGTGTGCAGGA
CGAATTGGGTAGCCAACCACTTGCGTAAGGCCTGCACGACGTGCCAGCTCCCGTTTAACGCAGCCACTCGCCGTCGATACCACTGCCGGCTTTGCGGTGA
CATCTTCTGCCATCACTGCGTGATCGTCCGCAACGTCCCGCGCGACTACGGCGAAGACAACAAGTCGCGCATCTTCCAGGTGGCCAAGACGCACTTCTGC
AAGGCCTGTGTGTCTACTGCACGCCGCGGAAGCTCAGCGACGAGTGCTCGTGCTTCGTCGGCCACACACGCCAGCAGCGTCGGGAAGCTCAGCTCGGAGA
GCAACAGCCGCACGTTGCGAAAGGCTGTGAGCAACATGACCGAGCAGAGCACCGCTCGACCCGAGTGGTGGGATGAGGTCGTGTCTCAACATTCCGAGTC
TGATTGGTCCGAGACGGACTCGGAAGATGCCAGCAAGGCGTCGCTGAACGCTTCGGGACGATCAAGACTCGCTAGTTCACTGTCCTCGTCTCAGTCGTCT
TGGACTTCTCGCGTTGACAACAACTTGGAAAAGGAAGAAGCGCCGTTCGTTGTTACTCTGGACGTCATTGACGACGACATCGCCGTGTTGGACGAGAACT
CACGTCCATCCAAGTCGAGACTGCGCAAGACGCTGTCGATGTCGGGACGATACTCGATTAGTCGAAGACAATCGAACCGGAAGCAGCAGCGACCGACGGA
TGCGCAGGAGGTGACCGAAGTGATCGATACGACGGACATGATGCCAATGTCCGAGTACCGTAGGCAATCCCGGGCCGGACCCAGCGTTGTGCTACCTACG
CGGAAGTACAGCAAGCGCCGCAGTGGTCGGGATTCCTTGTTGAGCTCAAGCGGCCCTCGGTCGGGCAGAGGCATGAGCCGAGACGAGCCTAGCAACAGGT
TTCAATCGTCTCGTTCTATCAGCCAATGCCTCGCTGAGCAGGAAGAGCTACTGCGATGCATGCTCAGTGTCAGTCGAGTGCACTCGAACCCTGGTCGGTC
GAAGAGACGGAATGCGAACGCCGAGAAGGTGAACTTTGCCGCGACGATGCCAGTGCCGCGCCCTACCGTTCGGCTATATGAGGCTTAAAACATCGATCGG
CATTACACCCAGAGCAAAGTTATCTATTATTTAGTGAACCATTTAATGGTAGTCG