Description :
From Genome Similarity Track
Location :
Scaffold_866:8871- 10285
Transcript NameFunction/comments
g16274.t1ETK94054.1 hypothetical protein L915_02834 [Phytophthora parasitica

Sequence
1414 bases(100 bases per row)
GACGAAGGTGAAGTAGCACCGCTCCTGAAGCCGTCTTGGATCTCGGCGATCGTCATGTCAGACGTCTCGGGCACCATAAAGTGGATGAAGATGATCGACA
GCACCGTCGTGGCCAAAAACGGCGTGAAGCTGTAGTTCGTGATCGCCTCCTCGATATACGGGAATGCAATACCGATAGCAAGCGTGGCCAGCCACTTTAC
AGTAATGCAGATACCCACCGCGGCGCCACGGGCCGAGTCTGGGAAAAGCTCTGCGATAATCGGCCAGAGCAACGGGCCAATACTCAAATCGTAGCCCACC
ACAAAGATACCAAGGAAAACGATGGACAGCCAGCCAACGCTGTACGCCAGCGAGAACGTCATGCCAATGCAGCACAGCACCATCACAAAAATACCCCACG
TCAACATGGTACGCTTGCGCAGAATCTTGGTCAAGGCAGCAGCGATCGGCACTGGGATAACATTTAGAATGTCGATGATCATGAGACCAGCGCGCGAGTC
AGAAATCCCGGCATCCTTGAGGATTGAAGACGAATAGAAGAACACGGCGTTGATGCCCACAAGTTGGTTAATGCAGGTGAGACCCAGAGCAACGATCAGT
TGCTTGCGGAACTTGGACTTTGTCATGATGGACCAGTTGGTCTCGTGCTCCGTCTCCTTGACGTTCCCACTCAGAGTCGAGGGCAGCTTGCTTCTCCGGT
CATTAGCTTGAATCCAGCCCATCATAACGTTGACGTTCTCCTTGCCGTACAAACGTGCAAGCTCCTTCTCGGCATCCTCCTCTCGGCCCTTTGAGACCAG
CCACACTGGACTCTCCACCATGAAGAAGAACGACATGACCACGAACGCAGCAGCGAACAAGATCGGCATACCAGCGATCCAACGGAAACCCGACGTCGTG
TTCCAGTACCAGAACGTCGTGGCCACACCGAAGATGCCGAGCGTCGCGGCCAAGTGCGTGTTGGTGCCCAGCGCGTGGCGGTTGTGCGGCGTCGAGATCT
CGTTCAGGAACGTGTTCACCACGGCCATAGCCACGCCGTTCGCCACGCCCGTCACGAAGCGGCCCGCCGCGAACCACGTCGGGTTGTTGGCCACCACTTG
GACCACCGAGCCCAGCACCATGAGGATCGCGTTGAAGCGCAGCGTCGTGCGACGCCCCCACTTGTTGGACGGGAACCCCGACAGCAGACTGCCGAACATG
CCGCCCACGATCCACGCGTTGACCAAGAGCGTCCACGTCGTCTTGGTGTGGCCCGGGAACATGAGGCACGTGCCGTCCTCGACCGGTCGCGCGTTGCAGT
CGTCCGTGTTGCTGAAGGTGCTGAGGTTGACCTGCGAGTTGGACCAGCCGTAGTGGAAGGCCTCGAGCATGGCGATGGCCACGGACGAGTACACGATCCA
CGTCGGCCGGAGCG