Description :
From Genome Similarity Track
Location :
Scaffold_12:887083- 893652
Transcript NameFunction/comments
Physo_412311Hypothetical protein

Sequence
6569 bases(100 bases per row)
GCTTGACTTCTCGCGAGCCAAAGTTGTGCTTGACGCGCGCAACTACTCGCTGACCGGCACGGGCAACACGTTCAGGCGCTGGCGCAGCTTGCAAAACTGC
TGCGGTCCGAGTGGCTTCGTAAAGATGTCCGCGATGTTGTCCTCGCTCGGACAGTACTTCACCTCGAACACATCCCGCTCCACAAAGTCTCGGATCTTGT
GAAACATCAGATCCACGCTTTTGACCTTGTAGCTGCTGCTTACTTGCCCAATCACTTGAATTGCAGCTTGGTTATCGTCATAGAGAACCGTCGGCTGCGT
CGATATGACCTTCAGCTCCTTGAACAAGTTGAGCGTCCACATCACCATGTTGGAGCACTCACTAGCAGCCACGAACTCGGCGCAGCACGTGTCGTCCGTC
ATAATAGACTGCTTCTTGCTCTTGTAAGCAAAAGTGCAACCATTCAACTGCCGTACAAATCCTGTGATCGATCGACGGTCATCTTTTTCATTCCCCAAGT
CTGCATCTGCAAAAGCGACCAATTGCATCCCAGGCGACTCTGGCTTGAACCAGACCAGGCCAAACTCACGCGTACCCTGCAGGTACCGGAGGACGCGCTT
GGCCAACACGAAGTGCTCCTTCGTGTAGCAGTTGAGAAACTTGCCGAGCGTCCGCACGGCGTTCGCGATATCCGGCCGCGAACAGCAAACCAAGTACTGC
AATGAACCCACAATACTTTGATAACCAACATCCGGATCCATGTTCACACATACAGGCTCCTTATCCGAATCTCCCGGAAGCTGGAAGTTTCCCTTGGCCT
GCGGAGTCGGCACCGCCTTACACTTGGCCATCTTAAAACGCTCGAGCAGCTGGTCAATGTAACCACGCTGCGAGATAGACAGCATCTTCCCCGGAACGTA
CTTGATCTCCATGGACAACAAGTGGCTGACCTCACCAAGGTCTTTGATCTTGAACTTCTTCTCGACCTCACTGAGCACCAGCTCCGTGTTCTCGCAAATA
CTTGTCCAGCATTTGATACCATATCCGTGGGGCCTGCTTGAGACCGTACAAGCTCCTCAGTAGCCGACACACTCGCCCAGACCCATCATCGAAGATGTCG
GGCTGCTCCATGTAAATCTCACAGTCAATGGGGCCATTCAAAAATGCCGTGACAAAATCAACATGGCGGACCAGCAATCCATAGTCCAATGCAAGCAGGA
GCACCAGCTTCACTGCCCTGCACTCACCACCGGAGCGTAGGTTTCCCAGTAGTCCAGCCCATATTTTTGTTGACACCCTTTATTGTGATACGAGCACGGG
GTCGGACCACCTCACCTCGGGCATTTCTCTTGCGAACAAACACCCACTTGCTCTTCAGCACCTTGGCTCCCTTCGGCCTTTCCACTAATTCCCAGGTGTT
GTTACGAATGAGCTCACCAAACTCGTTGTACAACGCTTCCACCCACTTCTCTGCATCCGGAGCATTCAATGCAGCATCCGTGGATGTTGGCTCCAGCATC
GAGTTGACTGCTTGGATAACCAGACTCTCTGGGAGCTCAATGTCATAATCACAGTAGCGAACATTTGGCTTGCGAATGCGCGTCGAGCGTCGAAATGATG
GCCCTGCACCGGTGTCCTCCTCCTCATCATCATCTTCATCATCACTACTTGACGACAGAACTGCTTCTCCCACTGAGCTCTCGGCCCTCTCCACCGGTTC
ACTGGAAGCGACAACTTCATCACTCTCTGCAACATCATCTCCGTCTTCGTCTTGGTTGTCATCAACAATTTGGCAACTCTCTCAAAGAAACTGAGCGACG
ACGGTTAAGTACGCCCTCAACTTCCTCAGAGTCACTTTCGTGCTGATCCTGATCGACAGCCGCCAAGGCTTCACTCGCTTGCTGCGGCGCGCTCGCAGGC
GACAGCTGGACAGCAGCAGGGGCTGCTTCCGCTGGAGGCTCACTCCTAGGTTCAGACACAGGCAATCCCATGCTGACGGAGTCTGCTCCACCACTGCACG
CGAGTCATGACCATCAACCAAAGGCACCAGACGTTGGCGCTTTGCAGGAGGGGCAGCCAGCTCATCATGAGTCACTGCAGCCATAACCGGGAGACGTACG
AGCGGGATAACATCAGGAAGGACATTGCGACCACGTTGATAACGATTCGCAATCAGGTGCTCTACACAAGAGCGCTCAACAGTCCAGCCCTCATCAAACT
CCACCGAACGACGCTCTTCGATATTTCCAGTCCTTAAATTCAACACCCGAACGCTATCCGAGTTCTTAGGAAAACCCACAAACATACCCAGCTTCCCAGG
GTTCTCCAACTTGTTGGCTCGCAGCTTCTTGGGAGTGAACACATGCACAATGCATCCCCACACTTTCAGCAATTCAACATCCGGACGCTCTCCGAATCTC
CGTGCGTAGGGTGTCTCTCCACCAAGAGCGCTTGACGGACTCACATTCACAACCTCTAGAGCATACTTGAAGGCCGCACCCCACAGACTAGACGGCATGT
TGGCGGTCGTCAACAGACTCCGGACCCTCGCCATCATAACGCCGTTCATTTTCTCGACAAGGCCGTTCTCCTCTGGACTATAAGCATTCGTCCACAAGAA
CTCTATTCCTCTCCCCCGGAGGAATGCTTTCATCTTGTTGTTGACCAACTCTTTGTCTTGGTCCGTAGAAAATACCTCGATGCGATGACCCTGCGCTAGC
AGCCATTCCAGGTGCGAAGTAACCACTGCTCGTGATTCTTCCTTCGCTCGCACGAGGAAGCCCCATACATATCGCGTAGCCTCATCCTGAACCAGTTGGA
AATGCTAGTATCCATTGTACGTACTCACGCCAACAGGACCAAAGTCTGACATCAACGTCTGGTATGGGTCCATTGCTCGTCGAGTTAGAGTTTTCTTGTA
CGACATACGCTTCTGCTTAGAAGCGATGCAGGTCCAGCACTTCTCGTCCCGACCACCGGTACAGTCTGCAGCACTACCGAGTCCATCAAAGCCAACAGCA
GCTCCTTGCGTTACCATTTGACGCAAAGCAGGATAATTGAGGTGAGCAAAGCGCATGTGCCAGCGCTCAAACTCTTTTGCCCTCGCCGCACCTGCTGCAC
TCAGATTTGTGGCAGCCGCAGTTGTCACCGCACGCACCTCTCGGGTTTCTGCTGGTCTTGCCTGAAGTCGATACCGGCCCCGGGTCTTCTTCAGCTGCAC
CTTCGAACCATCTTTCGTCAAAGTGCAAACCCGATTGCCATTATTCTGCGTAAAGTCCAGCTCCCATCCACTCTCTTCAAGTAGATGTGAACTCAGCCGA
TTATCGGGGCCAGTCGGTGTGTGAACAACTCCAGACAATGTCAACACTTCGTCCTTTTGAGAGGTCACACTCATTACTTGAAGACTTACATCCCCAATCA
TGCGTTCGCCTTTTGGCTGTCCATCAAAAGCTAGGAAGAGATGCTCTCGGTCCGTCCGTGAATTGTCCAGCAACTTTAAATCAGTGCACACATGTACATC
GGTCGCCGTATCCAACACCCACTCCATGACGCGAGGCTTTCGGCGTCGAGGACCAACCACAGTCGCTCCAATCTTGCGCTGTGTCAATGCATCAATGGTC
CTCACGGCCCCGCCACCATCACCGCCCTTTTTGTTTTGAAAACGCTTGGCTTCCATGCCAGCGTACGGCTTCTGATTCTGCGGGCCGTCGGTCTTCTTCG
GGTTTGGACAGTGTGCGCGGATGTGATCCAGCTCGCCACAATTCCAGCAGCCGTCATTCTTCTTACCACTACGGGATTTGCCAGGGGCGTCCTTGCCCTT
TGCTTTGTATCTCCCCCGACCTCGCTGCTTCTTGCCTTTTCCAGCATTGACAGTGCCAGAATTGCCATTGCTCTGCTTGCCTTGATTATTGGCGGCCTTC
TTGGCCGAACCAATGCTGCGAGGCATTTCCTCCCCCACTTTCTCGTCGAGGTCCTCCTCAGCAAGTAAGGCGTTCATCACTTGCGCAGCAGTAGGTGTCA
TCTGCTGTGCTCCAGGCAAAGCAAGTGCAGCATAGTGGCGAGAGAACTGGCGAACTACTTCGCGGTGCGTACGGGTCACATTGGCGAGCAGGATTTCAGC
AAACTCCTCATCACTAATGACCTTGCCATAGTGAGACAGATCTCGCCGCTGTAGTTGCATCTCTCTCAACCAGCCACTCATATCCATATCACGAGTGTAC
TTGTTCGAGTAAAGCTGCTCACGCGCAAAGATGTAGTTGGCGAACTCACGTTTCGTCTGTTTATTCTCGAACCTTATCCACATCTCCCTTGCTGACTTCT
CATGACAAATCATCTCTGCATCACCTTCCGGAACTCCACGCAGGATGGCTTCCCTCGTCGCGTTGTCACGAGCGTCAAACTCTGCTTGCCGGTTCACATC
AAAGAGCGGGCAAACATCACTGCCATCGATGATGCCCCACAAACCCAAGCGAGTGAGATATGTCTGCAGCTTGTTGGTTTGTAGCTTGTGGTTGAGGGGG
CAAATTCCGAAGTGAGATTAAATGTTATCGTCTCTCAAATTACTCTCTAGTCTTCCCCTCCTGCTTTCCTTCATGTTCTCCTTGTGCTCGTTGGTGCCTC
TCATCAGACGGATTACTCCCGGGTTCCGATTGACTTGATCTCAGTATACTTGGGTCTCCCTGACCAGCCATTGGTATATCCAGAGCCCGGCTGCCGCCGG
CTCTCCCGTCGCCGTCGGATCCTCCGAGTCATCGGTGGATGTGTCCACACGTTCTCCCCGTCCATGTGCATCTATTGGCGGTGCTCCCGAAGACTCATGA
ACACTCCCACTCGCCGCTAATGCTGCACGACCGTCCCGACGATTCCCCTTGCGCTGATCAGGTACTTGAGCCTCTTCGTCCCCAACGCCTTGGTAAGCAT
GTCCGCGAGCTGGTCCTCCGTCGGCACGTAGTTGACGACGATGAGTCCTCGGGACACATTTTCGCGGATGAAGTGATGCTTGATATCCACGTGCTTGGTC
CTCGCGTTGTACCCAGCGTTGCTTGCGAGGGCGATCGCGCCCTGGTTGTCCTCCCATACTTGGGTAGCTGCCACTTGCTCGTGACCCATGTCCTTTAGCA
TGGCGCGGGTCCACAGCTCCTCCTGCGTGCACAGGCTCAGCGCCATGTACTCGGCCTCCGCCGAGCTGAGCGCCACCGTGCGCTGGTACTTCGACTTGAG
GACCACCGGCGCCCCGCTAATCATCACCATGATGCCCGACACCGAGCGTCGGTCGTCAAGATTGCCGCCCCAGTCGGCGTCGGTGTACGCCGTCACCTCG
ACCTTCTTCGCGTTCCCATTGTAGGCGATGCCGATGTCTCGGGTGCTCTTCAGGTACCTGAGCACGCGGATGGCAGCCTTCCAGTGCTGCTGCCCGGGGT
TCTCGAGGAAGCGCGACAACTGGGTCACGATGTACGCCACATCAGGTCTGGTGCACGTTGTAATGTACAGCAAACAGCCAATGAGTGCTCGGTAGGGCTT
CGCCTGCATTTCCTCACGTTCCTTCTGAGTCATCGGCGACTGAGTCTGCGACAACTTCATGCCCGACTCGCACGGGTTCACCACCACCTTGGCGTCCTGC
TGGTTGAACCGCTTCACCACATCACCAATGTATCGAGTCTGCTTGATCATGAGAGTCTTCGCCGATGAGTCATGGTCGATCTCCATACCGAGGATAAACT
TGGCCTCGCCCACCTCCATCATCTTAAACGCATTCTTGAGCGCCACCTTGACTTCCTGGATCTCGCTGCTCGTCTTGGCTGCGATGATCATATCGTCCAC
GTACAGGCAGACGTACACGAACCTGCCCTTCTCGCCCTTGACGTATGGACACTGGTCACCGCCGCAGCTCCGAAATCCGATGCCCACGAAGACTCGGTGG
ATGGTCTTATGCCAGGCATTTGCCGCCTGCTTCAAACCATAGATCGCCTTCTGCAGCCGACACATCATGTTCTTCGCGTTGATGATTCCGTAGGGTACCT
CCATGTACACGCGCTTCATCAGCCCGCTGTTGAGAAAGGCGGTGTCCGCATCCAGCTGCTCGGTGATGTACGCCTCGGCCACCACAACCGACAACACCAC
TCGGATCGAGTTCATGTTGGCCACGGGCGAGTACGTCTCGAAGAAGTCCACGCCATACTTCTGCTTAAACCCTTTCGCCACCAGGCGGGCCTTATACGGG
ATGACTCGGCCGTGCTCGTCGCGTTTCTTTGCGAACACCCAGCGATAACCGATCGGTCGAGCACTCGGTGTCCGACGGACCAGCGTCCATGATCCGTTGT
CCGCGTGTGCCTTGAGCTCCGCATTCATTGCCTTCACCCACTCCGACGACTCGTCGCTCTGCATGGCCTGCTGATACATGGTGGGTGCGTCATTGGCATC
GCCGACGTCTGCGGCGTAGGCCAGCACCGCCTCAGCCAATAGGCTGTCTTCGTCCACCCTGGGTCGCTTTAGAGACGGTGGCCAGAAGTGATCATCGTTG
TCCGAGTCATCGGGACCATCTTCTTTCGACTCCTCGCCGTCTGCGGAACCATCTCCAAGCAGTAGTACC