Description :
From Genome Similarity Track
Location :
Scaffold_133:88708- 92291
Sequence
3583 bases(100 bases per row)
TCATATATGGGAGAATCCACCAGAGGACCTGCATACTCTTCCACAGCTTCTAGCTCTCGCTCTGTAGTCACTTCAAACGCTAACGCTGTCCAATCTGTAT
ACCGTCGTGATCCAACCAAAACGAATCCCGGTGGTCGAGGTATCATGTCAGATTCTATCCACAATAACCAGTGAAGTTTCATGACCTATAATTATATCGC
GATCGCTGAGGCTCATAAACTGTAAATACTTGATCTGGCCAGGCCCACTAGTCACTGTCGGCACACACGCCACGTCTCACCTCATCCAAAGTTTGGCCTT
ATGTGGACCAGCCCCAATACGTATTTCCGTCGATTTGCCCACCGGAATGACCACGTGTTGATCATTCACGCTGATCACCTGCAGGGCTAATCGATAAGGT
GGCTTCCGTCCTGCCAAACCAATTCGCACCTCGTCTGGTAGACATAATTTTTGTCGGCTAGATCCAGACGAATGCCTGCCGGAACCATGAAATCCATACC
CAATCTGGCTTCTTGGCCGACTTGATCACCGACCCAAACATCGAAATTATACACCAACGACCCGTCCAATTTAATCTTGGTCTTCTTCCGCCCCACCGTC
ATATATATATATGCATTTCCTCCAATTCCGACGCACTCTTAGTTTGACTTTCGTCGATCACACATCATACCTTACGAGCAAAGGTAGTATCGAGGATCGA
CACGTCAGCGCCATTGTCGAACAGCATAGTTACATTCTCATTATGATCTTGCCCACCGCTTTTGCTTGCTTGAACCATTTTCCGAAAGTGTGGTATTTCC
AATACCCGCGTGATTCCCTTGGTGCGAGGTCGAGCTCCATCCTCACAGGCGATCGGGCGTAATCGTTCACTCTTTCCACACTTGATATTGATGAGACCAA
TGTAGAATCATTATGTATATTAGCGATCGGATCGATCCGATCGTTAATCTCTTGATCCTCCCGTTGTCCTTCAACAAATGCATAAATGCAAAGCCTAGAA
TGCTCGTCTCGGGTCAGATTCCAACCTGGCGAGCGTCCTAGTTTAAAATCTCCTTCATCATGGGCGGAAACATCCCAGAATGCTTCGTGGGCACGTAACA
TTTTCGGCTCAAATTGAAAAATGCTTTCATAGGGCATTTGCTACTCTCGTGTATTTGTCCGCATGCTGCACTCACAAAGAAACATATGTCAGAGGGGAGT
CCTTTGTGACCATAATTTTTGTACGTCAATCTCTTCCAGCACCCTCGATCATTGTGTCTGGTAGATCTACAATGGATACATGTCTTCGATCGTCCACCAT
GATCGTGTCTATCCCTTTCACCATTGTTCTTCTGCCAGGCGCGGTGATCCTTGTCCAATTTTTCTCGGTCAGGTGTAGTAGTCACGCAAACTCGACAATG
ATTCACGTCCTCACCGGATCCAATTGACATCGATTCCTATCCGCTCTTTTAGACTTTCTCGCGGATCGCTCGCACCGCCCGAGCTGTATTCGACGACATC
GGATTTGAAGACGTGGTCGTTCGCTGATGGAATTTGATCGATCTAATCGACGCTTTTACTGGCGATTATTCATCGGTTGGCACGCACGTAGGGTTTTCTC
CACCTCGTCAACATCCATCAATCGCAGAAGTGTCAGCTGTTTTTCCAGATTACGATCATCCAGCGTAGCAATGAAGTATTCCACATGTTCGTGACGTGTG
GTCAAGGTAGCCAATATTTCTTCTTTGATCACTATCTTGGCGTGCTTTGATGCGACATTGAGAAGATGAAGATAATTCAGCGGGGTTTCATCTGATCGCT
TCCGTGCGAGACAATATTGCCTAGCCACAGACACCCCTTTCCCTCATAATGAACCATAAAACAATTCAGCGATTGTTTCCACTTTTGCCGTGTAGATCGA
CTCAGTTGGTTGTACCAATTATGTGCTGGCCCTGTCAACAGATCGACGAACACCAAACACTTTTTTCGTCAGGCGCCTAATCGCGCAGGAACGCCGACTT
GACCTTGCTGATCCAGCTTCTGGCCCGATCTTCATCTCTGTCCTTGCCACTTAATTCTTTCAGCTCCGTCATTGCTGACACATGAATACGCTGGGGAATT
CTACCACGATTCGGCAACGTTTCTGCAGCGGATACCAACTCAAGTCTCCGCTCTCTTTGCCCCGAATCATCGAGAACGGCATCGTCATGATCAAGAATGT
CCAATCGACTGAGATGCGATCGGACCCATTCCATCTCGACCTTCGGGGTATATGCTTCTTGAGATATTAGAGATATTGATCCTTTGGCTAGGGTAGATCA
CTTGATAAGCTCTCTCCCATTGTTCTTGTTGAAAACGTTCCATGGCCTCTTCGAGGTACGCCTGCATGTGTCCTTGCGTAGTCAAATTCTTCTCTTCTTT
TGCACGTGCGGTCGTCGATCGTGGTTCGATCCTAATCGTTTCAACCTGATTACGCAGATGTGCCGCCCCACTTGGGCCTAGAGACATCCGCTGAATACCG
ATCGAAACATCGGAATCGAATTCAGATTCAGCTGACGCGTACAGCAACTATCCAGTGTATTATCCTCTCGGGGCGTCTACGATCGCTGCGTCCGCTTGAT
CCTTCGGATCACACTTACCCGTTAGGGGAATTAACTTGTCGATTAGCGATCAATCCGCATGGTCACCTGATCTTCGTCGTACTCCAAAATTTTGTTGGCG
TTGAATACTCCAGCGACACTACAAGCGTCATGTAGCTGCCGTATGATCCCGTTGATCTCTTCCAGCATTTTAGACGCTACCGCCGGTAAGGGTATCGGAT
TTTGGATCCCTCCTATCAGCTTGGGCTTCAGAATCCGGAGCACTGGGTCACTTGATAAAGATTATTGAGTATCTTACAGTAGTATCCCTCCGCCAACTGA
TCCAGCTGCTAACCTTCCATCTGTTTCTATTATCGACCACGAACTTTATCGGTCGATTGATAGACTTCAAGCTTCGATCGTGGTGCTCCGACCTGGGCGC
TTCTTTCTTCACTCGTGCTGTCTTCACGTTCTACGTCTTTGACTTCCCTTGAGTGGTATTGGCGGATAATTGTTTGATTTTAACCGAAGGGTTTTCACCC
AGCATATCGTGTTTTATGGCATGATCCGCGGTGGACCCCGAAGAAACCTCAGGAAGGGGTAGAGGTTTCTCTTCCGGATCGATCGATCGATCTTCCTCTT
TAATTTTCTTATCTTCCGAGCCCCTCCCAAAACTCCAATAATCTAAGGATCCTTTAAATTAACGCGTCTGCGGCGATCCCTCTGCATCTGACACTTCCAT
CCCAGGATCCTTTATTACTTCACCTATGCAATCCGGGACTCACGGTAAAATCCCGAGTCACCAGAAAATCCTAAAACACTCACCATTGTAGTGTAGTGGC
GATCGCTCATTTTATGAGGCGAACCCAACTCTCCACTGGTGCCCAGACGACCGACTATCGGAGGGGGTACTCCGTTTCCATGCCTTGTATTTCCTTCCTC
AACTTGTGTACCCGTCAGTAGGGCGGGCTTCACTCTTCTCGGTGGACTCGTGTCGAGGGAAAACTTGACCGTGTTGGGGATGG