Description :
From Genome Similarity Track
Location :
Scaffold_485:8870- 11549
Sequence
2679 bases(100 bases per row)
AATGCACCACAATTGGGGTTCGCTTCATCCACCTATGCTTCATCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTTAGCTTCGATAT
GTGCACAAGCGGAAATAATCGGTATGGTTTTACTTCCACTTCCAGCCGTACTGCATGTTCCCCACACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCTAACTTAAGTGTTGCTTCCAACGTCGATCGCAGGTCCCATACGTAAATAAGATAGAACGGAGTATCACCGCAAC
CTTGGTCTTGCGCTGTATTGATGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTAGTCATACTTGTGAGAGAAATTCGACATTAGCACAGGCTCGTGATCATGACGACCAGATTCGCTAGCCCCAAATCGCCGGAAGACGCAN
NNNNNNNNNAATTGTTTGGACCGTTATCGACGAGCTCGCCTTAGCGATATTGTAGCCAGAAAATTAATCACCCAAAGAAGCAATTTAGTATTTCCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCCCTTGATGACCATCTTCCATACTTAGGTGGTAATGTGTAGAATATCATCTTGAAGCAGCTCCGCGATCACCAGGCG
AACGAGCTCAGCACGATCATCGAGATTTGTAACCAATCGCGGGCGAAAATACAACAGTCCGTCTTTATCTAACACGTAGTCTGAAGCATTCACGGAATTA
CTTTTGCTTCAACAGCACCNNNNNNNNNNACAGTCCGTCTTAATCTAACACGTAGACTTAAGCAATCGCGGCACTTACTTTTGCTTCAACAGCACCCAGC
TCAGTTACATCTCCGACTATGTAAAGCCAGGTTAGCGATCCTAATTTCTTCGTCTTGCGCCTGTTTGATACGGTCGAGTCGCATCTCCTGTACTACGTCT
TCTTGTATATGGGTAAACGCTTCACGCCTTCGCATTGTCGATCGTGTAATCGCTGCCATCTTGATNNNNNNNNNNTGTATTATGGATAAACGCCTCACGC
CTTCACATTGTTGATCGTGTAATCGCCGCCATCTTGATCNNNNNNNNNNTCATACCAAAGACCTTTTACAGCTGTAAAGAGGTGCTAGCCAGTCGATCCG
CACTTTGATACCAATCGCGCTTAACGTATAAACTCATGTGTCGGCCACGACCTAAGTCGATCTAGGACTTTGAAATGCAGTAATTGTAGTCCTGGTGCCT
TGAAATCAATCTCACCCCGCATCTGCCTGACGACTAGATTGGAATCATCACAGATGACAACTCGCCCCCTTGTCTGTTTCGCTAGNNNNNNNNNNTGAAC
TCATGTATCGGTCACGACCTAAGCCGATCTAGGACTTTGAAACGCAGTAATTGTAGCCCTGGTNNNNNNNNNNTGTTAATCCAGTATCAAAACGCGACGG
TGTCGACAGTATTGTCCATTCGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTGTATTG
GTTGCTTTCGTTGTGCAATCGCGATCAACATTTCATCTATATCNNNNNNNNNNGTAAAACTCGCTACGAGGGTGCCAAGGATTTCCTCCTCCCCTATGTT
ACGCCGACTAATCTCCAACGTTNNNNNNNNNNGTCTGTATCGGTTGCTTCCGCTGTGCAATCACGATCAACATTTCATCTATATCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAAATAACAGGCCGATTCTAATGATCATGTCCTTTTAGCAAAGCTGCGGGTACCGCCCATT