Description :
From Genome Similarity Track
Location :
contig_68:88656- 91016
Transcript NameFunction/comments
g9627.t1hypothetical protein

Sequence
2360 bases(100 bases per row)
CGATAGCCTCTCCCCCACCCAAACTCGAAGCCGGTGGCAACGATAGCGGCGTACGCGGATGCCGCAAGCCATTTACGTAAAATGGGGTGAAACCCGTCGA
CGAATGCACAGCATTATTCAGCGCAAACTCCACTTGGGGTAGCAGCGTGCTCCACTTGGTGGGTCTTCAGCGCAGACGCTGCGCAGTACGTCTTCCAACA
CACGGTTCACGCGCTCCGTCTGACCATCGGTCTGTGGATGGTCCGCTGTGGACATGTCCAATCTCGTACCGAGAAGACGGAACAAGTGTGTCCAAAAGTG
TGACACAAAGCGCGGATCTCGATCACTCACGAACGCCTCCGGGAGGCCATGGTGTCGAAAGACATTATCGACGAAGAGCTGTGCCGCTTGCGGCGCCGTC
ACGCTCTTCTTCACCGCGACAAGCCGCACCATCTTGCTCAGTCACAGACGAAGACCAAGATGCCAGTGTGGCCGCGCGTGTCCGCCGGAAGCTCAAAGAT
GAAATCCATGCTCACCGAGCGCCAACAGTCAGCCGGCACCGGCAAGCTCATCAATGGAGCCGACGACGATGGGGCGGGCTTCACGCGTTGGCACGTCTCA
CACGTCTGCACGTACGTGCGCACCCACTTATACATATGTGGCCACCAGAAGTTGCGCGCCACAGACGTATACGTCTTCTCTCGGCCAAGATGACCGCTGA
GCGGCGTGTCGTGTGCCTCGTAGAGGACTCGATGACGTAAGTTCTCGTCGTTGGGAACCACGATACGGGGCTCGTCGCTTTCGTCTACCTGATAGTAGAG
AAGATGCTAGTGAGTAGCGGTGCAACCGTGAGCGCTGCCGAGCAGTGAGTTTCACAGCCTTTTCAGGCACCTTCAGTGAAGTTACGAGATCGGCGAGATC
GCCATCCTCTGCGTACGCCTCGCGTAGCAGCTCATAGAGTGGGGACTCGAGATACGCAACGTGCGCCAGCTCATAGTCCGGCGCCGGGACAACGCGTCCG
CGAGGACGTTCTGCTTCCCTGGTTTGTACTCCACCGTGAAGTTATACTCCGCAAAGAAGGAGAGCCACCTCGCCATACGCTGGGAGAGGTGGGGCGACGA
CGTCGCTGTCCGCAAAGACGCATGATCTGTGTAGATCACGAAGGGTTCGCTGCCAAGCAGGTGTACCCGAAACTTTACGAGCGCGTACTTCATCGCCAGA
AGCTCCTTGTCATGGACAGGGTAGTTCTTTTCAGCCGCCTTGAGTTGGCGCGACTGGAAAGATACTACCCGTTCTCTGCCATCGGCATCGACCTGAGCAG
GGCACAGCCTATGGCGAAGTCGGATGCGTCGCATACCACACTGAAGGACGATCATCGTCGGGCAAAGCCAAAATCGGAGCGCTCTGCAGGCTGCTTTTGA
TTGCCTCGAAAGCCTGCTGGGCTTCATCGTTCCACGACCATTCCGCCTCCTTCTTTAAGAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTAGTTGGCGCT
GTACTTGTGTAAGTAGTTGGCAAGGCCAAGCCACTTGCGCAAGTCCTTCTGGATACTGGCACTGGCCATTGTGCGATCGCGCATATCTTCTCAGGGTCCG
CACGGACACCATCCTTGCCAAGGAAACATCCCAAGAAGGGAATCTTCGGCTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGATTCTCGCGCATGC
ACATCAATACCTCGCGGAGGTGGTTAACGTGCACTTCGACAGCCGTCTTCTCCTGAGGCACGACTGTGCACGAAGATCATCAAAGTACGTCTGTACGAAC
TGCCGCATCGGCCGGAAGAGTTGAGTCACCATCGATTGAACGTGGCTGGTGCGTTCGACAGCCCCTGGGGCATCACGAGCCATTCCCACAGCATCCCGCT
GGGTGTGCTCACCGCTGTGAGCGGGACGTCTGATTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGTCGAGTGCACTGAAGATGGTGCAGCCCGCC
ATGTTGTTCTGTAACACGTCCTTGCGAGGGATTGGCGTGGACGCCGGGATGGTTGCTGCATTCAACTTGTTGAACGCATGTACCATACGCCACTTCCCAT
TGGGTTTACGCACGCAAAACGTCGGGACGAGTGCGGCGACTTTGACTCGCGCACCATGCCCGCGGCATATTTCGCCGCGAAGAATGCGTCGATCACATCG
ACTTGCTCCTTCGGTAGTGGCCATTGGCGCGTGGTGCAATATTTGGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTCGATCTGGAGGTAACACCG
ACGGTGGGTTATCGCTGACCACATCCGAGAACTCCTTCAAAAGGGGGTAGTACGGATCCG