Description :
From Genome Similarity Track
Location :
Scaffold_8:88635- 89846
Sequence
1211 bases(100 bases per row)
ACATTATGCCTGGTCAAAGTACGAAGGGCGTCCGCGGGAAAGATTTCTTCGTGGGTGAAAAAGAGTTGATGGCCTTTTTGGATCAGCTGGATCTCGGTAC
GTATGATTATGCTTAGTGGGGATTTTTTAGTCTAACGACTTGTGTTTGCATAGCGGAGCTTCGACAGCAGAGCTCTAAAAGGCCTGTACCAAATCCACAA
GTCAGTACTGCGTGTGATCCTCCAGCCCGGAGTCGAGGGGAGATTGAAACAGGTATGAATTGCTATCCTGTATTAGATGCAATATCAACTGATTGTATCG
TGTATCATACAGCCGTCGCTACATCCAGCACCCCTGTACGAGATGCAACTGAGTACAACGACTCAGGACCGCCAGGTAGCCCAACTGAGTTACCAGATAA
AGCGATTTGTACAAGTAATGAAGGTATGATGCTCTCGTGTATAATAAATGCTTTAGAAGTCTAATCTTATTGTGTCTTGTACAGGTTTAACGGCCCCTAC
CAGCTCGCAAGAGTGCAGTGTTGGTGGTGATGCTCTGATTGCAACATCAACCCACATCTCGCCTGCATCGGGTGAAGACGGTGGGCTACTATTTTGTTGA
TGTGAAACTGAGGTATACACTAATGCGTGTTTTGGTTTGTGCCTCAGAGATACCACTTGCTCAGCGAACCTTAGAGTATGACCTGTTTGGAGATGACGAT
AGCAGCGAAGAAGACGTTGTTGAGAGTGACGAAGAGGTCGTGTGTAACGGGCCCAGGTATTTACTCCGTTACTTGCTTACACTATAGTGTTGAGGAAGCT
CGCAATAGGACGACTGAGTCTTAGGTTTAAGGAAAAATCAACTCTGACTTTATTTTAGGACCAAGGCCACACTCAAATACACGTCATAGTCCAATTGGCT
AATAATGGGTCTGGCTCCCCATATATCAGCCAATGGCATGACAGCATTTCAGCACACGCTAGTCGTGTGCTGATGCACCTACTTTTGTAAAGAAATCTAC
CTACTTATGTAATGGAGGGGCCCATTACATCGTGAGTCTCGTGAATGAAGGTGGCGATGAGATAGAACCTCCATCGGAGGAAGTGACGAATGAACCTGAT
GCAGTACAGCCTCTTGCGATAGGTATTGTTATCCATACACTTTTGTATTTTACGTTACTTATTCATATCGTGTATTCTCGTTAGTAGACGACCCAAACCT
TGTGCAGCCTG