Description :
From Genome Similarity Track
Location :
contig_114:88603- 97315
Transcript NameFunction/comments
g13399.t1hypothetical protein
g13400.t1hypothetical protein
g13401.t1RAW32487.1 hypothetical protein PC110_g11179 [Phytophthora cactorum

Sequence
8712 bases(100 bases per row)
CCGATAGCTGGAAGTTTGAGTATTTGACCCGACGACAATGCCCTCCGATCCTCGACGTGCTTCGAGAAAGACTCTGATCTTCCATCACAGATCAGCGAGA
CCGGAATCTTCCGATGCAGGCTCAAGGTCTGCATCGCAAAGACATTTAAGCACCAGGCCAGCAAAAGGTCTACGAGTTTTCTGGAGACGCAGACGAACTG
TGACTCCTGCAGGCTTGCGTTCGTTTGTTGTTGCGGAGCATCAATCATCAACTGGGATAAACTCAGCTACACGTCGGTCTAATGATCCCAACGATAATAT
CGTCTTCCTGAACAACCCGACAGAATTTGATCTGCGCTCCTATTTGTTCAAGCGGCGAAGATCAAGCATCGCAACAGATAGACTCGAGAGATCGGTCATC
AGTCAACGCTCTATTGGCAGCAGTCGTCGCAGTCACACGCCCGGGATCACATCGACAGGTTCATTCAAAGGGGAAGCTCTCTTTGAGAAACGAGCAGAGG
TGATGATCTCTTCTGCAGATGCATCGATCGCAAAACAAACGGGAAAACCGCGGCGTAGGCTACGAGCGAAGGAGGAATTATGCATCGTACTTCCTCGATC
CACTGCCCGTGGCCGAACGCGGTCTCAGAAGTCCTGGTTTCTCGGACCAGGATTTATTGGGTGCGACCCAGGAGAAGGCACGCTCGTAGTGACAAAGGAC
AAATCCATGGACGCAGTGCATGCCGAAATCTCTGTAGCAGGGGACGACTACTTCGTACAGGACGCTCAGAGCACAATGGGTACCTTTCTTTGCCTGAGTA
CACGCTACCGACATTATCCACAGAGGGATGGTTTCCGCTTGTGCCATGGAGACGTCTTCCGGATCGGACCGGCTACTTCAATTCGCGTTCTTGATCTGCA
AACAACCACTGAGACAGCTCCTATCCAAACCACGCGGAGCCGCTCTAGTTCTATCGCCAGCATTACAACCACAGCAGCAGAACAGTCTGCATTAAACTCT
GAGAGCAGTACATCTCATACCCCCAAGCTTGAAAAAACTGCAAGTGCCAGCAGCAACAGCGGTGGAAACGCACAACCAGGTTTGAAACGAATGTCGACCG
TAGAGGAACTTCGACTTCTCGCTGCTGATATTGAAGACGAGCTCATGAACGATGTCGGTAGAATCCATCCAGGAGTTACACCGCAAAATGAAGCCGGCAA
CATCACCAAAGATGACCACAGAGGGGAAATGCCTGCTCAATTAAAACCGCAGCACATCGTTCACTTTGCAGATACGCCCCCAATGATGTCGGATGGATCC
GTTTTCTTGGGTAGTCGCTACATACGTCCAGAAGTGAAGGAACTGCACTACTGTGAACCATCCCAGGTAGAAGATGCTGAGGATGATACAATCAAGCAAC
TCGTTGGAAGTGAGCACGAATCACCACCAACAGAGTACGCTGGCTCAAACATACGCCGGGCTGCATCGATTCGCCTCGTCATTTTCCAACATGACTCTGC
TAATGCCAGTACAGAGCCTTTAAAGCCGCGTGAGGCTCGCGAAGTGACACTGACTGGCCAAGGAACGTATCTCATCGGCTCCTCAGCTGCTTGCGATGTG
CGCATTTTTCCGTCGGAAGGTATTGAAATCCGTGCTGTGCACGCTCGGATTTTATTTGACGGCACATCGTTCGTGTTGCAGGACGTATCATTTGAGCGCG
ATCCACGTCGACAAACACGCGTTTTACTCACCCAAAGACCCGTGAGAGTTACACGAGGCGATTGGCTACTACTTGGTAAATGTGCGCTGTACATCACGAC
CGTGGCCAGAGCCTTTGGCTCGGTGCGCCGTCCAGATATGAAAGAAGCAGCCATGCGCTTGGACGTTTTGAGACTTTCAAAGCGAAAGCCAAGGACACGT
GGTTTATTCGTGCCCGTGGGGTTTCGATTGCACTCGTCATCAGGCTCCGGAGCGTCTAGCGGGAGTAGTGGATGGGGTGGCAGCAGTGGCGGGCCTGTCA
CGTTTGGCAAAGGGCGAGACTGTGACGCACAGGTTTTCACGGCGTCTCTAGCGACCGAGCAATTCAGCGTCCAGCTTGAGCGGGGAACATGTTTGCTCAC
GCCTAAACCAACAGGAATCAACGCTGGCACATACTTCTTGATCGGACGTGATGAACCTGGACAGCCATTCCTCGAAGATGGAGGCTACAACTCGAGCGAC
ACGGAAGAATCCAAATTCGAGGTGGTCAAACATACGAGCAAGCCTCTACTGCTATCGGAAGGGTGTGTCTTCAGGTGTGGCGGGTGCGAAGTGGAGGTAA
TCTATTCAAAAAGCGCGACTGCATCTGATTTGAAGAGCACTGCTGCTTTTGAAGAGCAAGAGCACATCCGGTTCTTGAGTGGCATGCCATGGTTGAAACC
AATTGTCTCCGACTTGAAAACCATTACGAACGTTGCACGCTGCGGCCAGAGATTGAAATTGGGCCCGGGGGAGTTGGTATATGAGAAAGGTGACGCAGCA
AATTTCGTGTTTATCGTGATCAGCGGCGAGGTGGCGCTCCATATTACCTGTGCGAACGATGAACAGGAAGGGGATGACTCGGAGATATTGACTGAACAAG
TGACTGCCGGCGGATACTTTGGAGATGTGAGTTTGTACGACCCGATGGAACTGTACGCTTCCGCACCAAACTGTGATGGTCATGAGTATCCTGAAACTGC
GCGAGCTGCTAGCGCTTGTGAGCTGCTAGCATTGGCTAGAGAAGATGTTTGCGGGTATCTGGGTTTGTATATGGATATTGTACGCGCTCATCTGCGCCAC
GATCAGTGTCGCGACAAGACCATCAGACTGGCATGCATTTGTGTGCCATGGCTGCGGGGGATCTCCCTCCACGAGATGCGCTTTCTTTCATCACAAGCTG
AAATTGCTGTGTATCCTCCAGGATCGATCCTGTTTGAGGATGGAAAACTTTTTGTCCCCGCTGCTTTTGCTGGCGGAAACACATTTCAACTGCGGGATGG
GTTTCTCGTGCTCATTCGTGGGGATGCCCGGATTGTCAGAAGAAACATGAGCGACAATATCGGCGAAGCAGAAAAATACACCAGGCAGAGGATGTTGAAG
AAAGAGATTTCGGCGACGTCGACGAGGAACCAGAACAGGATCATGACGAGTGGTGGAGCCCAATGGATCCAGTACTTGCATTGAGCTGGAGCTCGTCTCC
GTCTGTGTTGAGCGTTTCTGATCTGTCATTTCGTCTGGAAGCTTGCTCCACCGTTGAGTGTTATTTTGTTGCTGCGGTGCATCTCGCCCATCTGGATGTC
GATATCGGAACCAAACAACAGCACACTACCTCTTTTGGGCCAGAGGCGTCTTCTGTCGCCCAGGCTCCACCACCATTGAAACGAGTCCATTCGTTAGGTC
CTAGGCGAATGCACCATTCGCAGGTCGTGACCAGCGCTTTGCACAGTGGTGGAAACAGTCATGGAGACGACGATGACCATAACTCGTTGGACGGGTCCGA
TGGAGAAGGTGATAACACCGCAGCTCGCCGATGGAGACGCAAAAAGCGTAACAAGCATCTTCTCGAGCAGACAGTGCTGGAGACGCAAAACGACGCGAAG
ATACCAAACGCGTTGGTATTATACGTGCTGGCGGGGGCTCAGAGAGGGATATCCACGTGGTTCGCAACGTGGCATCAATAGGCGGCTTTCTTAGCGGAGC
AGACATCGAACTCAACGACCGGTATATATCCCGTGCACATGCCGTTATTGAATACCATGAAGGCAGATACTGGTTGTACGACAACTGTAGTAAGTGGGGA
ACCTTCGTACGCCTTGAAGAGGAGAACGCCGTCGACATCAATCCAGGAGACGTCTTTTTGGCCGGCGAAGTTGAGTTCACGTGCCTCACGTCGTACCCGG
AGCGAAATAAACCCAGCATGTGCTGTGTAATGTAAGCCATGGCGAACCAGGCCGTGAAAAAGAGTAAATCGTAATGACACTGGATAGAGTACCAGCTTGA
CCAGTGGCTTTATTCAACAGTCTTACATGACGCCAGAGATGAAGCAACCAGCACGTGCGCTAGTTCACTCGTTTGAATAAATTCCTGTCCTGATCGGATA
TCAACACAGACTGGACCGCTCAAGGCCTGAAGACCACCCACAACAGGCAAAAACTCGATCCAAACAGTCTTCGCTGTCTTGGCTTCTACCATACCAATAT
TCTGTGGCATCATGCAGAGCCACACCAAAGAGATCAAAAATGTCAATCACTAGCTACCCTTTTAAAACAGCAGATAGTACTCAAACTTACCTGGTGAGAC
GCTGACGAACACACAATACCGTGCATAAGTTCCTTGCGGAACTGTAGTTGTAGTGCGAGGCTTCGAGTAGAGTTGTTGATCACCGATATAGGCACCAGGA
ATGGTTGTCCAACCGCGACTTCCTTGGGTAGTTCCTCAACAATCACTATGACTTCGCTATGCTGCCCTGCTCCAACGCCAGCATGGCCGGAAGCTCCAAG
AGCTTTCCGCATAACTGGCTGACTCTGCACTGATCCTGCTTCTCCCATTGATATTTTCCACCCAACATGTAGTCGGCCAAGGTTTTGCGAGCCCTGGACA
AATATACACAAAATAACATCTTTTAGATCGAAGAACTTCCCAATTTCGCGCTATGAGGCATTACCTGCGCTGATAACAACGTCGGGTCTGACATGGGGTC
GTACGATACACGGAACACACGTTGCAGCTCCTCCTGCGGGTATACAAGAGTCTGCGGGCCATTTGTTGCGAGAAGGTCCTGAACTGATAGTTGTTCTCCA
TCTGCCTTCTTACCAGCAACGTGCATCTCTTCCGATGTAAACGGCGGCAAGGGCAGGAATTTGATGCTGTCCACAAAAAGTGGCAGTTTGGACACATTAC
GGATCTGAGCCTCAACGATAGCCTCGCCCTGCTGCTGCTGCTGGTTGTTAGCTGCCGAATTCTGCTTGAACGTGATCACCAATGGGTTCTGCACTGCAAA
CCGGTAGAATTTGCGGAGCGACTTGCTTTCGCCGGTCACGGGGTCCACGTAGGTCACGCCCACCCGTAGCACGTGGTTCCCCACCTGATTAAGCGGATAA
TCCACTACCATATCTAGACTGGAACCTGCAGGCAGCACAGCCACAGGATTCGGTGGCGGCAGTTTCCCCGTCCTCGCGTAGCGGTTGTCATGAAGCTCTA
CCCGGTCGTTGGCACATTGGATGTTGGCCGACAGCCCGACGTCCCGCAGCTCGCACGAGTACGGGTTGATGACGCTGATGTAGCTGCTGAAGGTGTTGCC
CAGAAAAATCTCTCTGTCATAGTAAAATGCATATAAAACATATTACAAGTAAGACACATCATCCCAAATATGACAATGAAGAAGCTTTTGTCGAACCCGA
AGCTGTCGGGCAGGATGAGCATGCTGGACAGCGCGAACTCGTGCTGTGTGGCGGTGACCTCGTCCAGGGACGCGGGCAGCATGGAACCCCCGGTAACGCC
CTGCGCGTACAGCTTGGGCTTGTACAGTCGCATCACTAACAGACAACAAACAAGAAAATCGTATCAAGAGGAATATTTCAGATTAGAGTACAAGAGCCGC
AGAAGAAATAGACTGCCACCTTTGAGCGTGGGCTGCACGGACGGAGAGGACGCTGGCGGGGTGCTCCCGCCGCCGGAAGAGGGCGGGCCGCTGGTCCCGT
AAGCGGAGCTCATGATGAAGGAATAATGGATCGCAAAGTTGCGCTCTCAGAATTATGTTGCTCTATCATTTGCGCACCGTAACGTTGCTATGTTGCGCTG
GTATTGACCCCTCATTTGCTTTCAGAATAGAGGAAGATGCTTGCTCGCTCGCTGTTCCGCGCCGCCTCGAGCGTCCGTGCGTCGCCGTCGCTGGTCGCTT
CCTTCGCCAACGTTGGCGCAATGCAAGTTGCGCGCTTCTCCGACGCCCCCACGGTGCGATTTGTCTCGAAATGTGCGTCGAATTACGTGAAAACTCTCGT
CTCAAAGGTTGTTCATGATGACTGCGTAACGTTCAGATGCACGGCACGACGATCTTGTGCGTCCGCAAGGGAGGCAAAGTGGTGCGTTGGATAGAGCGGA
GAAAAGTGCATCGCGTATGTTAACTTGGCGAAGAAGGAGGGCTAATTGTTGCTGTAGTGCCTGATCGGAGACGGCCAGGTGTCGCTGGGCAGCACGGTGG
TCAAGCCCAACGCCAAGAAGGTGCGTCGCATCGGCGAGCACATTGTGGCAGGCTTTGCTGGCTCCACGGCGGATGCGTTCACGCTCATGGAGCGTCTGGA
GGCCAAGCTGGACGAATACCCGGGACAGCTCACGCGGTCGTGCGTGGAACTGGCCAAGGCTTGGCGGACGGACAAGTACCTGCGTCGTCTGGAGGCCATA
CTCATCGTCTCGGACACCAATCAGTCGTACACGCTGACGGGCAACGGAGACGTGCTGGAGCCGCACGACGGCATCATAGGCATTGGCTCGGGAGGCACCT
ACGCTCTCGGTACGTGCAGCCTGGTGTTTAGTGAGCTTTTTATTGTTATTTTTGTGGAGATGATTGACAGCGCTGTGTTGGACGTTGTAGCCGCTGCCCG
TGCGCTTATCGACCAGGACCTGGACGCCGAGACCATCGCTCGCAAGTCCATGAAGATTGCCGCCGACATTTGCGTCTACACGAACGAGAATGTTACTGTG
GAGATGCTGGGGGAGGGGGAGTCTGAGGCCAAGACTGACAACAAAGAGTAAGATGAGGTAGAACAGGTTGCACTGAGGCGTGTAATTCGTCAGCAACGCT
CGAGTAAATACAAGGTCTGAGCTGTTGAGTTGAATCGCCTAACCATTGCAAGCAGAACGTAACCAAGGCACAATGGCGTGTCTGAAAAATATGAATATGA
TAGTCGTGGTCGGGCAAAGGAAGACAAAGAGAACGCTAACAAACGTCACCGAAATGACTGCCATCGCCGTCTGCCCCGTGAATGCAACGCCAGCATCTCG
GTTGTCAGTCACAGTCCACAGTAGTGTGGCACGCGAGGTGCCAGATGTCCTTCGTCCCTCGTCCCTCGGAAATTGTGATGGTTGAAGGCGTGTATAAGAT
GTAGTATTGGTGCGCGTGTGCGTTTTCCTTTTCCTGATGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGAATGTC
TTCTAGCGGGCCCATAACTCTCTTGAACGTTTTACGGTCCAACGTGAGACACTTAACCTTGCCCTGGGCGGTCACTGTTGCCTGACGAGGCCGAGTTGTG
AGCAGTGCGATTTCACCAAAGTACGCGCCGGATGTGAGCTGGCCCATTTCCACTGGCGGGTCTGCGGGCGAGAGCTGCTTCGTGCACACTGCCGAGCCTT
CCTCAATAATGTAAAACAGGTTGCCGTCGTCACCCTGTGCGATGATGACTTCGCCATCACTAAACGTTTCTGTCTTCAGAGCGTCTGCGACTGTGAGACG
CTCGTACTCGCTGAGCGACTCGAGCAGTGGTACACGCTCAATGAAGCCCTTGTGGGCCTCGCGTTTCTTCAATGTCGTTTCCATGATGATAAACTTGAAA
GTCTGGCGATCTAATGCCCACGCCTTCGAGTGCTGCACTGCTTTAACGGTTGCTGCTCGCGGAGCATTGTACATGAGGGCCAACTCGCCGAACGACATTG
CTTCAGTGCACTGCATCAGAAGACAAAAAACATGAGCACCCTGCCACTGAAAAAAAGCCAGAAACCCCTTCAGTAGTGAACCCACCGTCTGTACGAGATC
GCCGTCCTTGTAAACTTCACATACGCCGCTCTCCAGAATGTAAAAGTTATCTCCGTCGTCACCCTGCTTGATGATGGTGTCACCAGGCTCGAATTCCTTG
GGGAACATGGCGTCGAGCACAATTTCGTGCTGCTTCTCGTCCAGCGACTTGAACAAAATGTTCTCCACGACCATGCGACTGATGCCCTCCCGCTCCTCTG
TAGACTTGGGGTGCACCACGCGCTCAAACTGCCGCGCACTGCCACGTCACACCAAGTCAGTTTACCATCAGACAGGACAGCGCCACCTCATAACAAACTG
CTCACCTCAGCGGGTCAATGGTTTCAGCGGACACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGCGGCGGCGCGCTGGCTGCGATCTCGCCCACGGC
GTCTCCACCCTCATCCTCGTCCTCGCTCTCGGACTCGTCCGAATGATCTGCCAAGAAAATGCACATTAGATCTCCATTCTCTACCATTAGGTAGTGTAAC
TGCCCACGACGCACACTGCACGTGGGGCGAGGCGGCTGGGTTGTCCTCCTTGGCCCCAGGCTTGCGGCGAGGTGTGGCCTCCTCCGGGTAGTTGGTCTGC
AGGTACTGGATGATGTGCAGGATGGGGTTCTCGGGCTTGGCCAGCAGCAGCGACTCGACGAGGTTGATGAAGAGCGTGTTGATGCCCTTCTTGTGCAGGT
AGTCCTGCAGCTCCTGTTGGACGCCCTCTGCGTCCGTCATGCTCCTGTGCGGCGAGTGTCTGTCTTGCGAGTGGCTAGCTGGATCCTTCCGTCTCGGGCT
TCTGCGTGGGCCTGAAAACTAAACTGAGCCTGGCGTCACGGGGCCTTCGCTCCAAAATGGAAGAAACCCCTGCAACAGACGCTGAACCCAAGCGAAAGAT
CGCCCCTTGTCG