Description :
From Genome Similarity Track
Location :
Scaffold_77:88584- 96350
Sequence
7766 bases(100 bases per row)
TGAACTGCCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCA
TCTTCGGGATGGAGGCCCTGCTGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAAAGCATTCGACGCGTACGAGCAGGGCAGCATCGC
GCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGC
GAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGAAGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTGCACTTTCCAACCTTAG
CGGCCGTGCTAAGAGTTGGGTGTACACAAGGGAAGAAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAAACAGCTCCGAGCCGCGTTCCT
CCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACG
GCGTCCCTAGTGGGACACCCACTCAGCGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGC
AGTCAAGCACTCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAAAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAACATGGCCTGGGAGTTCTTT
GTCGGCTCCCGGCCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGC
CACTTCAAGCGCGAATGTCCTGCGGAAAGACTCCGCAGACAGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGG
GGAGCGCTGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGTCGCGTACCATGGGGACTTAGCCCCT
GAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCTCTTTATCATCTTGATAG
ATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGCCCGATGCTTTGAGAGAAAGCAAGGGCAACGGAACGGT
GGCCGTGCGACTGGCCGACGGGAAGGTCGTCACTGTTCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACT
GTTCTCGATATGGATCGATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCC
GCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAACCATCCGGCAG
ATGCTTGGGAGTCGTCGACGTATATTACGACTCCAAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGTCGGCCAAGTGGGTAACTTAGGTCAACAG
GCGGGTAAATTAGTTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGCTCCACTCACGGTCGCCCAGACCT
TAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGA
CGTGGGCAGCAAAGCCCGACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCGAAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGC
GACTCGGAGCCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTGTCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTG
TCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAATCTCGAGGAAATGACGGTTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGA
GATGGTACTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACCCCTCCTCTGTCTTGAACGAGAACGTTCTGGAAGACTTGGACAAGCAGCGTCAGGCG
CGCTTGGGTTCCGAGATTCTTAAGAACCCCAAGGATCCGGTGTATCATTTGGTGAAGGAGTATGCGGACGTGGTGAACGAACACCCACCGACCCAACTCC
CACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCAT
TGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAAACCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAG
TGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGA
GCGTACTGTACAGTGCGCTAGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTACAAGCGGCAT
GCTTTGGGAGTGGCTCGTCATGCCGCAGTGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATCGTTCCGCCCTTTGCGTACCTTCGTA
CAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCAAAGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAA
TGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGAGTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGC
TGATCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGTATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTAC
AGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGCCTGGCGCTGGGAGCAGGAGCACCAGGATGGTTTTGACAGCA
TCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGC
ATTGCTGCAGGCCGACACGGCTGGACATGAGCGAGTTATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGAG
CTCCTGGCAATGAAGTATGCCCTTGTGAAGTTTCGTGATCACTTTCTGGGCTCACGGCCATTCGTGATCTACACAGACCACGCATCCCTGCGGACGGTGA
CAAATTCGCCTCACCTCTCCCAACGGATGGTGATGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCT
TGCGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGAGACGAT
GAGGCTGTCGCGCCTATCGGCAAGTTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGT
TTAAAGAGGGTCTCCTCTATTACCGGGTGGATCCCACTGATCCTCCACGGATGGTCGTACCCACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCG
CATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGT
ACGTTAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCGACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGAT
GAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACATGGCAACACCGGAATTTTGGGGTTCGTGTGTCGGCTGAGCGAGATGGTACATTTTGCTCCA
GTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTGGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACC
CGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTCCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGA
GCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTTGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAAC
AACGCGGTGCACGCGTTCACAGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTA
TTTTAAGTGGGGGAGACGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAA
GCTGAGCATTGTCAGTAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTT
GAGGTTTGGGGCTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGGTAGCTCTGTCGGCAGCAGCAAGCTGAAGCACCGCTTCATCGGACCTT
TTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAGGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTT
TGACCCGCAGGGGGTTGCTGACTCGCAGACTCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGACGTCGGAGCAGGCACCC
AAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGC
CGGGTACGCACCATACGCGTACGTCTGGGGGTGCGCCGCAAGCGGCTCCGATTGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCC
AAATCGGACGAAGAGGCACGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACTTGCAAGACGAGCTGGCTCGCCCT
GATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCGCAAGCACGAGGACACGTTGACGGAGACGGTCAACCTCAGGGTCCCG
TGTCGGACCCGCAGCCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCTCTGCTTGACCGGAA
TGGAGAAGTCCACTTCCACGTGGAGCGGATCCTTCAGGAGCAACGGTGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTAATGCCCACTCCGAG
AACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACCGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTT
CTTGCCCGAACGGGATACGGACGATGAATACATTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGCCCCTTGGCAGCATGCGC
TTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGT
ACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCTACGTGGGACAGTTCTCGGGTATAACCCAGGGGTATCCCCAAAGAGGATAGAG
ACCACCCCGGGTCTCGGGCTTCCTACGACAAGTCGTGAAGTCCTTAAGGGGAATACGGTGTGGCGCGAGAAGCACGCACCGAGCAGCCTCCAAGTTGTCA
ACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGGACCTCTAAGAAGA
GGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTG
GGCAGCTTGGAACTCCTACTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCCTTCTCTTCTTCCTCCTTCTCCTCC
TCTTCATACGAGGAGTCGAAGATACTCTGATAGAGCGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGC
TCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGAGCCC
TTAGCCTTGGCGGCCGGACTTTCGGAGCGCACAGACGTTTTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCAC
TGGGCACTGGGCTATGCCCTCCCACAGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCCAC
GAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCTTGCTTGCGCGCTTGTCCACAACCGCGTCACCCGAGGATCCGATCGCC
TCGGAAGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGACAGCAGCATTGGAGCGTGTCT
TAGCACCGCTCTTTGCAGTGTCACGAGGCATGGTAACGGTCAAATTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGT
GAGCCTCCGTCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTTTTCACTCTGATTGGTCGGTAAACCGA
GCCTAAATGGAGGAGGATGTAACGGTGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACCTCACACTTCAGGTGTATGACACGTCATACT
CCGGAATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAGTCATTGGTCAAACGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAA
ACTTAACCTACCTATACATATACTCAGTTTACAATCTACCTTAATTAGGTCACTTCGCTCTCTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTG
AGAGTTTGTATACTCTCGGAAGATAAATACCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAGAT