Description :
From Genome Similarity Track
Location :
Scaffold_103:8858- 10768
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_103-snap-gene-0.19Transcription factor

Sequence
1910 bases(100 bases per row)
CCGCCGAGAGCACGATGCAGCCCGTGCAGGACCCGTCGGCCGCTGGCGCCGACGCCGCGCAGGCCTTCAACTACGAGTCCTACCAGCAGTATGCGCACGA
GCGCAGCGTCCACGACCAGGCCATCCACTCCATGACCGCAGCCGTCGGCTNNNNNNNNNNTCGCACGAGGGCTGCGACAAGGCTGCGCAGTCGAACTTCC
TGTGCAAGGCGCACGGCGGCGGCCCGCGCTGCCAGTACCCGAACTGCACGCGCAGCTCGCAGGGCGGCGGCTACTGCCGTTCGCACGGCGGCNNNNNNNN
NNCGCCAGTACCACTGCTAGTGGTGGGGGGCCGACCCGTCCCAAGCTGTCCACGAACGCGTCGGCCCCGACGACCAACTCGTCCGCGCCATCCTCGACAT
CGTCGTCCCCGGCCAAGAAGACCAGTACGGCGGCCTCGTCCTCGGCATCGAACGCGAATGGGACCAGCACGAGTACCGTGAATTCCGCCAGCCGCAACGA
GTCGCTCAAGTCCAACAGGCTGTGCACTATGCCCGGCTGCAAGAAGCGTGTGCGATCCAAGGGACTATGCAAGGCGCACGGCGGCGGACGCCGCTGCATG
GTGGACGGCTGCGAGCGGTCGTCGCAGGGCCAGGGCCTGTGCATCCGCCACGGCGGCGGCAAGCGGTGCACGCAGCCCGGCTGCACCAAGGCCTCGCAGA
GCAACGGCCTGTGCAAGGCCCACGGCGGTGGGCTCCGTTGCCAGGCCCCCGGATGCACCAAGTCGTCGCAGGGCGGCGGGTTCTGCCGCGCACACGGCGG
CGGCCAGCGGTGCGAGAAGGAGGGATGCAACAAGGGGGCCCAGCGCGGCGGTTTCTGCGCGGGTCATGGCGGCTCGCGGTTCTGCCAGCACCCGGACTGC
ACCAAGAACGACCGCGGGGGCGGCTTCTGCGCCGAACACGGCGGCGGCAAGCGATGCGACCACCCGAGCTGCAACAAGCCCGCGCGCAAGAAGGGCAAGT
GCTCCTACCACGCGAACGCCTTGAAGGGCAAGGCCCCCAAGGACGCACTGGCCGGATCCTCGGCTGGGTCTGCTGCTGCAGCGGCTGCGGCTGCTGCAGC
GGCCGCTGCGGGCGTCTCGGGGGTTAATGGCGGCCTCCCGCCGCACATCATGGACATGCGGCAGCTCACGACCCCGTCGGCGTACGCGCAGATGGCCAAG
GACCTGCGCGGCGACCCGGCGGCCGCGAGCCACGTCGGAATGGACCACCGCGCGATGCCTGCCGCGTACCAGCGCGTCGAGTCGATGGACCAGCGGTACG
GCGCGTCTGCGGCCATGAAGGCGTACGACTCGGCCAGCCAGGGCCCCCCGCCGCCCTCGGCCTCGTATCTGTCGCTGCACACGGACCAGCGGTCGTACGA
GCCGCTGGGACTGCAGCCTGGCGCGGGTCAGTCTCGCCATTACGGCCTGGCGATGGACTCGTCGGCACTGCCGCCTGTATCAAGCGGCTACAAGATGGAC
CGCGCGCCAACGGCGGCGTACGGCGCGGCCGTGCGCGGTGACTACGCCAAGTCGGCCGGCGTGAACCCGTACACACAGCAGTGGTCGAAGGAGATGCACC
CGGACGCGCGCGACTACTTTGACATGAAGGAGCAGCAGCAGTCGCAGCAGCAGCAGCAGTACGCGTCGTCGCAGTACCACCACCACCTCGCGGACTCGGC
TGCGGCCTACGGCGGCCACGCGGCGGCCCAGCCGCGGGGCANNNNNNNNNNNNNNNNNNNNNNTACTACCACCCGGTCCAGGGCCAGCAGTCGGAGCAGG
CGCCGCCCGCGGGCTCGCAGACCCAGCCGCCCAACATGATGTACTACTCGGCCAACGGGTACCAGCCGCATCAGCTGCACAACATGCCGCAGATGACGCT
GTTATAGGCC