Description :
From Genome Similarity Track
Location :
contig_114:88571- 97281
Transcript NameFunction/comments
g13919.t1hypothetical protein
g13920.t1hypothetical protein
g13921.t1XP_009517245.1 cyclic AMP-dependent protein kinase-like protein regulatory subunit [Phytophthora sojae

Sequence
8710 bases(100 bases per row)
CCGATAGCTGGAAGTTTGAGTATTTGACCCGACGACAATGCCCTCCGATCCTCGACGTGCTTCGAGAAAGACCCTGATCTTCCATCACAGATCAGCGAGA
CCGGAATCTTCCGATGCAGGCTCAAGGTCTGCATCGCAAAGACATTTAAGCACCAGGCCGGCAAAAGGTCTACGAGTTTTCTGGAGACGCAGACGAACTG
TGACTCCTGCAGGCTTGCGTTCGTTTGTTGTTGCGGAGCATCAATCATCAACTGGGATAAACTCAGCTACACGTCGGTCTAATGATCCCAACGATAATAT
CGTCTTCCTGAACAACCCGACAGAATTTGATCTGCGCTCCTATTTGTTCAAGCGGCGAAGATCAAGCATCGCAACAGATAGACTCGAGAGATCGGTCATC
AGTCAACGCTCTATTGGCAGCAGTCGTCGCAGTCACACGCCCGGGATCACATCGACAGGTTCATTCAAAGGGGAAGCTCTCTTTGAGAAACGAGCAGAGG
TGATGATCTCTTCTGCAGATGCATCGATCTCAAAACAAACGGGAAAACCGCGGCGTAGGCTACGAGCGAAGGAGGAATTATGCATCGTACTTCCTCGATC
CACTGCCCGTGGCCGAACGCGGTCTCAGAAGTCCTGGTTTCTCGGACCAGGATTTATTGGGTGCGACCCAGGAGAAGGCACGCTCGTAGTGACAAAGGAC
AAATCCATGGACGCAGTGCATGCCGAAATCTCTGTAGCAGGGGACGACTACTTCGTACAGGACGCTCAGAGCACAATGGGTACTTTTCTTTGCCTGAGTA
CACGCTACCGACATTATCCACAGAGGGATGGTTTCCGCTTGTGCCATGGAGACGTCTTCCGGATCGGACCGGCTACTTCAATTCGCGTTCTTGATCTGCA
AACAACCACTGAGACAGCTCCTATCCAAACCACGCGGAGCCGCTCTAGTTCTATCGCCAGCATTACAACCACAGCAGCAGAACAGTCTGCATTAAACTCT
GAGAGCAGTACATCTCATACCCCCAAGCTTGAAAAAACTGCAAGTGCCAGCAGCAACAGCGGTGGAAACGCACAACCAGGTTTGAAACGAATGTCGACCG
TAGAGGAACTTCGACTTCTCGCTGCTGATATTGAAGACGAGCTCATGAACGATGTCGGTAGAATCCATCCAGGAGTTACACCGCAAAATGAAGCCGGCAA
CATCACCAAAGATGACCACAGAGGGGAAATGCCTGCTCAATTAAAACCGCAGCACATCGTTCACTTTGCAGATACGCCCCCAATGATGTCGGATGGATCC
GTTTTCTTGGGTAGTCGCTACATACGTCCAGAAGTGAAGGAACTGCACTACTGTGAACCATCCCAGGTAGAAGATGCTGAGGATGATACAATCAAGCAAC
TCGTTGGAAGTGAGCACGAATCACCACCAACAGAGTACGCTGGCTCAAACATACGCCGGGCTGCATCGATTCGCCTCGTCATTTTCCAACATGAATCTGC
TAATGCCAGTACAGAGCCTTTAAAGCCGCGTGAGGCTCGCGAAGTGACACTGCCTGGCCAAGGAACGTATCTCATCGGCTCCTCAGCTGCTTGCGATGTG
CGCATTTTTCCGTCGGAAGGTATTGAAATCCGTGCTGTGCACGCTCGGATTTTATTTGACGGCACATCGTTCGTGTTGCAGGACGTATCATTTGAGCGCG
ATCCACGTCGACAAACACGCGTTTTACTCACCCAAAGACCCGTGAGAGTTACACGAGGCGATTGGCTACTACTTGGTAAATGTGCGCTGTACATCACGAC
CGTGGCCAGAGCCTTTGGCTCTGTGCGCCGTCCAGATATGAAAGAAGCAGCCATGCGCTTGGACGTTTTGAGACTTTCAAAGCGAAAGCCAAGGACACGT
GGTTTATTCGTGCCCGTGGGGTTTCGATTGCACTCGTCATCAGGCTCCGGAGCGTCTAGCGGGAGTAGTGGATGGGGTGGCAGCAGTGGCGGGCCTGTCA
CGTTTGGCAAAGGGCGAGACTGTGACGCACAGGTTTTCACGGCGTCTCTAGCGACCGAGCAATTCAGCGTCCAGCTTGAGCGGGGAACATGTTTGCTCAC
GCCTAAACCAACAGGAATCAACGCTGGCACATACTTCTTGATCGGACGTGATGAACCTGGACAGCCATTCCTCGAAGATGGAGGCTACAACTCGAGCGAC
ACGGAAGAATCCAAATTCGAGGTGGTCAAACATACGAGCAAGCCTCTGCTGCTATCGGAAGGGTGTGTCTTCAGGTGTGGCGGGTGCGAAGTGGAGGTAA
TCTATTCAAAAAGCGCGACTGCATCTGATTTGAAGAGCACTGCTGCTTTTGAAGAGCAAGAGCACATCCGGTTCTTGAGTGGCATGCCATGGTTGAAACC
AATTGTCTCCGACTTGAAAACCATTACGAACGTTGCACGCTGCGGCCAGAGATTGAAATTGGGCCCGGGGGAGTTGGTATATGAGAAAGGTGACGCAGCA
AATTTCGTGTTTATCGTGATCAGCGGCGAGGTGGCGCTCCATATTACCTGTGCGAACGATGAACAGGAAGGGATGACTCGGAGATATTGACTGAACAAGT
GACTGCCGGCGGATACTTTGGAGATGTGAGTTTGTACGACCCGATGGAACTGTACGCTTCCGCACCAAACTGTGATGGTCATGAGTATCCTGAAACTGCG
CGAGCTGCTAGCGCTTGTGAGCTGCTAGCATTGGCTAGAGAAGATGTTTGCGGGTATCTGGGTTTGTATATGGATATTGTACGCGCTCATCTGCGCCACG
ATCAGTGTCGCGACAAGACCATCAGACTGGCATGCATTTGTGTGCCATGGCTGCGGGGGATCTCCCTCCACGAGATGCGCTTTCTTTCATCACAAGCTGA
AATTGCTGTGTATCCTCCAGGATCGATCCTGTTTGAGGATGGAAAACTTTTTGTCCCCGCTGCTTTTGCTGGCGGAAACACATTTCAACTGCGGGATGGG
TTTCTCGTGCTCATTCGGGGATGCCCGGATTGTCAGAAGAAACAGAGCGACAATATCGGCGAAGCAGAAAAATACACCAGGCAGAGGATGTTGAAGAAAG
AGATTTCGGCGACGTCGACGAGGAACCAGAACAGGATCATGACGAGTGGTGGAGCCCAATGGAACCAGTACTTGCATTGAGCTGGAGCTCGTCTCCGTCT
GTGTTGAGCGTTTCTGATCTGTCATTTCGTCTGGAAGCTTGCTCCACCGTTGAGTGTTATTTTGTTGCTGCGGTGCATCTCGCCCATCTGGATGTCGATA
TCGGAACCAAACAACAGCACACTACCTCTTTTGGGCCAGAGGCGTCTTCTGTCGCCCAGGCTCCACCACCATTGAAACGAGTCCATTCGTTAGGTCCTAG
GCGAATGCACCATTCGCAGGTCGTGACCAGCGCTTTGCACAGTGGTGGAAACAGTCATGGAGACGACGATGACCATAACTCGTTGGACGGGTCCGATGGA
GAAGGTGATAACACCGCAGCTCGCCGATGGAGACGCAAAAAGCGTAACAAGCATCTTCTCGAGCAGACAGTGCTGGAGACGCAAAACGACGCGAAGATAC
CAAACGCGTTGGTATTATACGTGCTGGCGGGGGCTCAGAGAGGGATATCCACGTGGTTCGCAACGTGGCATCAATAGGCGGCTTTCTTAGCGGAGCAGAC
ATCGAACTCAACGACCGGTATATATCCCGTGCACATGCCGTTATTGAATACCATGAAGGCAGATACTGGTTGTACGACAACTGTAGTAAGTGGGGAACCT
TCGTACGCCTTGAAGAGGAGAACGCCGTCGACATCAATCCAGGAGACGTCTTTTTGGCCGGCGAAGTTGAGTTCACGTGCCTCACGTCGTACCCGGAGCG
AAATAAACCCAGCATGTGCTGTGTAATGTAAGCCATGGCGAACCAGGCCGTGAAAAAGAGTAAATCGTAATGACACTGGATAGAGTACCAGCTTGACCAG
TGGCTTTATTCAACAGTCTTACATGACGCCAGAGATGAAGCAACCAGCACGTGCGCTAGTTCACTCGTTTGAATAAATTCCTGTCCTGATCGGATATCAA
CACAGACTGGACCGCTCAAGGCCTGAAGACCACCCACAACAGGCAAAAACTCGATCCAAACAGTCTTCGCTGTCTTGGCTTCTACCATACCAATATTCTG
TGGCATCATGCAGAGCCACACCAAAGAGATCAAAAATGTCAATCACTAGCTACCCTTTTAAAACAGCAGATAGTACTCAAACTTACCTGGTGAGACGCTG
ACGAACACACAATACCGTGCATAAGTTCCTTGCGGAACTGTAGTTGTAGTGCGAGGCTTCGAGTAGAGTTGTTGATCACCGATATAGGCACCAGGAATGG
TAGTCCAACCGCGACTTCCTTGGGTAGTTCCTCAACAATCACTATGACTTCGCTATGCTGCCCTGCTCCAACGCCAGCATGGCCGGAAGCTCCAAGAGCT
TTCCGCATAACTGGCTGACTCTGCACTGATCCTGCTTCTCCCATTGATATTTTCCACCCCACATGTAGTCGGCCAAGGTTTTGCGAGCCCTGGACAAATA
TACACAAAATAACATCTTTTAGATCGAAGAACTTCCCAATTTCGCGCTATGAGGCATTACCTGCGCTGATAACAACGTCGGGTCTGACATGGGGTCGTAC
GATACACGGAACACACGTTGCAGCTCCTCCTGCGGGTATACAAGAGTCTGCGGGCCATTTGTTGCGAGAAGGTCCTGAACTGATAGTTGTTCTCCATCTG
CCTTCTTACCAGCAACGCGCATCTCTTCCGATGTAAACGGCGGCAAGGGCAGGAATTTGATGCTGTCCACAAAAAGTGGCAGTTTGGACACATTACGGAT
CTGAGCCTCAACGATAGCCTCGCCCTGCTGCTGCTGCTGGTTGTTAGCTGCCGAATTCTGCTTGAACGTGATCACCAATGGGTTCTGCACTGCAAACCGG
TAGAATTTGCGGAGCGACTTGCTTTCGCCGGTCACGGGGTCCACGTAGGTCACGCCCACCCGTAGCACGTGGTTCCCCACCTGATTAAGCGGATAATCCA
CTACCATATCTAGACTGGAACCTGCAGGCAGCACAGCCACAGGATTCGGTGGCGGCAGTTTCCCCGTCCTCGCGTAGCGGTTGTCATGAAGCTCTACCCG
GTCGTTGGCACATTGGATGTTGGCCGACAGCCCGACGTCCCGCAGCTCGCACGAGTACGGGTTGATGACGCTGATGTAGCTGCTGAAGGTGTTGCCCAGA
AAAATCTCTCTGTCATAGTAAAATGCATATAAAACATATTACAAGTAAGACACATCATCCCAAATATGACAATGAAGAAGCTTTAGTCGAACCCGAAGCT
GTCGGGCAGGATGAGCATGCTGGACAGCGCGAACTCGTGCTGTGTGGCGGTGACCTCGTCCAGGGATATGCGGGCAGCATGGAACCCCCGGTAACGCCCT
GCGCGTACAGCTTGGGCTTGTACAGTCGCATCACTAACAGACAACAAACAAGAAAATCGTATCAAGAGGAATATTTCAGATTAGAGTACAAGAGCCGCAG
AAGAAATAGACTGCCACCTTTGAGCGTGGGCTGCACGGACGGAGAGGACGCTGGCGGGGTGCTCCCGCCGCCGGAAGAGGGCGGGCCGCTGGTCCCGTAA
GCGGAGCTCATGATGAAGGAATAATGGATCGCAAAGTTGCGCTCTCAGAATTATGTTGCTCTATCATTTGCGCACCGTAACGTTGCTATGTTGCGCTGGT
ATTGACCCCTCATTTGCTTTCAGAATAGAGGAAGATGCTTGCTCGCTCGCTGTTCCGCGCCGCCTCGAGCGTCCGTGCGTCGCCGTCGCTGGTCGCTTCC
TTCGCCAACGTTGGCGCAATGCAAGTTGCGCGCTTCTCCGACGCCCCCACGGTGCGATTTGTCTCGAAATGTGCGTCGAATTACGTGAAAACTCTCGTCT
CAAAGGTTGTTCATGATGACTGCGTAACGTTCAGATGCACGGCACGACGATCTTGTGCGTCCGCAAGGGAGGCAAAGTGGTGCGTTGGATAGAGCGGAGA
AAAGTGCATCGCGTATGTTAACTTGGCGAAGAAGGAGGGCTAATTGTTGCTGTAGTGCCTGATCGGAGACGGCCAGGTGTCGCTGGGCAGCACGGTGGTC
AAGCCCAACGCCAAGAAGGTGCGTCGCATCGGCGAGCACATTGTGGCAGGCTTTGCTGGCTCCACGGCGGATGCGTTCACGCTCATGGAGCGTCTGGAGG
CCAAGCTGGACGAATACCCGGGACAGCTCACGCGGTCGTGCGTGGAACTGGCCAAGGCTTGGCGGACGGACAAGTACCTGCGTCGTCTGGAGGCCATACT
CATCGTCTCGGACACCAATCAGTCGTACACGCTGACGGGCAACGGAGACGTGCTGGAGCCGCACGACGGCATCATAGGCATTGGCTCGGGAGGCACCTAC
GCTCTCGGTACGTGCAGCCTGGTGTTTAGTGAGCTTTTTATTGTTATTTTTGTGGAGATGATTGACAGCGCTGTGTTGGACGTTGTAGCCGCTGCCCGTG
CGCTTATCGACCAGGACCTGGACGCCGAGACCATCGCTCGCAAGTCCATGAAGATTGCCGCCGACATTTGCGTCTACACGAACGAGAATGTTACTGTGGA
GATGCTGGGGGAGGGGGAGTCTGAGGCCAAGACTGACAACAAAGAGTAAGATGAGGTAGAACAGGTTGCACCGAGGCGTGTAATTCGTCAGCAACGCTCG
AGTAAATACAAGGTCTGAGCTGTTGAGTTGAATCACCTAACCATTGCAAGCAGAACGTAACCAAGGCACAATGGCGTGTCTGAAAAATATGAATATGATA
GTCGTGGTCGGGCAAAGGAAGACAAAGAGAACGCTAACAAACGTCACCGAAATGACTGCCATCGCCGTCTGCCCCGTGAAGGCAACGCCAGCATCTCGGT
TGTCAGTCACAGTCCACAGTAGTGTGGCACGCGAGGTGCCAGATGTCCTTCGTCCCTCGTCCCTCGGAAATTGTGATGGTTGAAGGCGTGTATAAGATGT
AGTATTGGTGCGCGTGTGCGTTTTCCTTTTCCTGATGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGAATGTCTT
CTAGCGGGCCCATAACTCTCTTGAACGTTTTACGGTCCAACGTGAGACACTTAACCTTGCCCTGGGCGGTCACTGTTGCCTGACGAGGCCGAGTTGTGAG
CAGTGCGATTTCACCAAAGTACGCGCCGGATGTGAGCTGGCCCATTTCCACTGGCGGGTCTGCGGGCGAGAGCTGCTTCGTGCACACTGCCGAGCCTTCC
TCAATAATGTAAAACAGGTTGCCGTCGTCACCCTGTGCGATGATGACTTCGCCATCACTAAACGTTTCTGTCTTCAGAGCGTCTGCGACTGTGAGACGCT
CGTACTCGCTGAGCGACTCGAGCAGTGGTACACGCTCAATGAAGCCCTTGTGGGCCTCGCGTTTCTTCAATGTCGTTTCCATGATGATAAACTTGAAAGT
CTGGCGATCTAATGCCCACGCCTTCGAGTGCTGCACTGCTTTAACGGTTGCTGCTCGCGGAGCATTGTACATGAGGGCCAACTCGCCGAACGACATTGCT
TCAGTGCACTGCATCAGAAGACAAAAAACATGAGCACCCTGCCACTGAAAAAAAGCCAGAAACCCCTTCAGTAGTGAACCCACCGTCTGTACGAGATCGC
CGTCCTTGTAAACTTCACATACGCCGCTCTCCAGAATGTAAAAGTTATCTCCGTCGTCACCCTGCTTGATGATGGTGTCACCAGGCTCGAATTCCTTGGG
GAACATGGCGTCGAGCACAATTTCGTGCTGCTTCTCGTCCAGCGACTTGAACAAAATGTTCTCCACGACCATGCGACTGATGCCCTCCCGCTCCTCTGTA
GACTTGGGGTGCACCACGCGCTCAAACTGCCGCGCACTGCCACGTCACACCAAGTCAGTTTACCATCAGACAGGACAGCGCCACCTCATAACAAACTGCT
CACCTCAGCGGGTCAATGGTTTCAGCGGACACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGCGGCGGCGCGCTGGCTGCGATCTCGCCCACGGCGT
CTCCACCCTCATCCTCGTCCTCGCTCTCGGACTCGTCCGAATGATCTGCCAAGAAAATGCACATTAGATCTCCATTCTCTACCATTAGGTAGTGTAACTG
CCCACGACGCACACTGCACGTGGGGCGAGGCGGCTGGGTTGTCCTCCTTGGCCCCAGGCTTGCGGCGAGGTGTGGCCTCCTCCGGGTAGTTGGTCTGCAG
GTACTGGATGATGTGCAGGATGGGGTTCTCGGGCTTGGCCAGCAGCAGCGACTCGACGAGGTTGATGAAGAGCGTGTTGATGCCCTTCTTGTGCAGGTAG
TCCTGCAGCTCCTGTTGGACGCCCTCTGCGTCCGTCATGCTCCTGTGCGGCGAGTGTCTGTCTTGCGAGTGGCTAGCTGGATCCTTCCGTCTCGGGCTTC
TGCGTGGGCCTGAAAACTAAACTGAGCCTGGCGTCACGGGGCCTTCGCTCCAAAATGGAAGAAACCCCTGCAACAGACGCTGAACCCAAGCGAAAGATCG
CCCCTTGTCG