Description :
From Genome Similarity Track
Location :
scaffold_18:88565- 90205
Transcript NameFunction/comments
Pl_112196conserved hypothetical protein

Sequence
1640 bases(100 bases per row)
GAGGTATGGATACTGGTGGATTAGAGTCTAGGTGTAAGAAAGGCTTGGATTCTGGTGGTGCAGAAGATTTATCGCGTGTGTTTTATTTGCAGGGCTGTCG
GAGTGTAAATGGGGCTTCTATAAGGGTGCAGAAGAGAAAGAAGCAACGGATGAGGAGAAGACCTCAAAGAGGCTTATTCACCAAGTCAAAAATCAGGACA
ATGTCCCATCTGGTGAGCTGGGAGATTTGACTGACTTGTGTGATTAATTGCTAAAAGAATGCGATAATGTGTAGCGGTGTTTACTGGACGATTGAGCATG
GATTGCCAGCCGACGGAAGTTGGTGTAGTTCGAAGTGGCTATTGCGCAGTGCGGGCGTCTGTACCACAGGATCTACTTTTGCACGGTTACGAAGGAATTA
CGATGCGAATTATGACGGACGGACGCGAGTACCGCATGAACGTGCAAATGGAGAGCTGGAACCCCTTCAATTTGTACATGGGTTTCATTCGGACACCACC
TAACGAATGGGTTGACATTACGGTGGGTAGTCGCCTGGCTTATCTCCATTTGTGTGCAACTAACACAGTGACTATGTGAAATTACGACACCGGTAGCTGC
CATTCCGCGACTTCTTGCTAACGGCCAAGGGCTTCGTGAAGCTTGATGATGAGACAGAACTCGATCCTTCCAAGCTCAAAAGCGTACGTTTGCTCTTGTT
AACACAAACCACCACGACTTGTCAAGTACTAACACGATGCGTTGACTTTAGGTCGGCTTTGCTATCGCTGATCAGAAGGAAGGCAATTTTGAGCTGCGTA
TTCAGTGGATTAAGGCAGTAGCACAATTAGGACCGTCGGACAAAGAGGATTACAACAACGACGATGATGATGACCGGTACGTTATGATCGTTCTCCCAAC
ATAACAAGCAAGCTAACCATCGCGTCTGTGCTCGACATCAGCTACGATAACTCCAAGAACAAAGGAGATTACTTCCGGAAACCTGCAGATTTAGTCATTT
AAAGAACGGTTGCATCTGTGAACTCTGTCTCAATGGAGAGGTTGTTCAAAGTTGCTGCATGGAATTAATGAACCTAGTTTTGGCACTTCACGAGATCAAA
ACAGAGCATGTTTGTGTATATCTATCTATGAGGAAGCTTCCTGCTCAACTTGTTACGCTTAGACCTCGTCCTCGTTCAGAAGCATGTTGGGGATGCCGTC
AATGATAGGGAAAACGCGACCGGACTCAGGGCATACGAGCTTTCCCTGCTTCACGTGCACTTCCAGCAGAGCGTGGTGGATCTTACGCAGAGTCTCTTCG
TCCGTAGCACCCTCTTCAGCGCTGGGAAGTGACTCTGGAAGACCGTCTGCGAGTTTGAGAGCCTTGGCACCCGTGAGGAACGCGCTCCAGTCCAATTTCG
TCAACATCTTGCGCACAAATGCGGCCTGGAAGTCGCACGCCACCACTTCCACGTCCTCAGCCTCAATGGACAACGGGTATCCATTCTCCACGCCCTTCTT
GTTGCACATGAGCAGGTTGTGTGTGATGAGACGCATGGCGATGAAGGCAACTAGGCACTTGGAACTGGAGCTGGTCAATTTGCATGAAGCGACTGGAAGC
GGCGTGTTTCCTAATCTAGGATGGTTAAACTAGGAGAATA