Description :
From Genome Similarity Track
Location :
Scaffold_631:8856- 17549
Transcript NameFunction/comments
Phyag_g7150transient receptor potential Ca2 channel (TRP-CC) family protein
Phyag_g7151hypothetical protein PHYSODRAFT_566381
Phyag_g7152hypothetical protein PHYSODRAFT_533462
Phyag_g7153hypothetical protein PHYSODRAFT_289190
Phyag_g7154conserved hypothetical protein

Sequence
8693 bases(100 bases per row)
TCAACCAACGGTAGCGCGTGGGTTGCTTGATCCGCTGAAGATTTTGGaattctgcagcagtcgtcgagctgcagctcgtgctaCTGGGCTCGACAGCAAT
GATACGCCGGCACCACTGGGGCGAGTTTCATCCCTGTCGCCGGAGCGCAAGTCCTGTAGTAGTTCGCCAAATCCACGCCCATAACTTACATCGCCGGAGA
AGATGTATGCTCGACCCTCACGCTCGAACAACTTGCCCAAGGTTGAATCCACACCTCGAGGTCGGTTGGAAAAGTAAATCGGCACAATTATTTTCCCCTT
GTCTTCGGCGAATGCCAACTGGTCGCTAACCAGCTCTGTTTTCACACTGCGTTCTGATAGCACGACCAGAAACACCGAGCTCTGCAGGATTGCATCTTTT
GCAGCCAAAATGCGCTCCTTGGTGCTGGAAACGTTCGTCATGGAATCAACCACGAACGGGAACTGGTAATGCCGGAGCTCTGTGCACAAATTTGTTACGA
AATCGCGATGGCAGTCGCCGTGAGAAACAAAAATCGAAAACGTAGGTCCGCCTCCAAACGTGTTCCTCCTTCTACTGCCGCGCACGATGACAGCGTTCAC
AATTTCATCCATCCGCCGGCGTCTCAGAGTGGCAGCCCTACCCAAAGGTTGATGCTGGCTTTCCGTCACATCGACAAGTTCTCGATCACCTCCAAGACGA
TGCATCTCCACCTCGTCTCGCAATCCGTCGATAAGGCTTCTGAGGCTAGCCTGAAATTTATCTTCGTCAATTTCAAACACGACATGGTCCACAGTTGATG
CGTCCGATATAGTAGAGCCATCTTCGCTGGGCTCTGCCGTGGTTGAGTGGTGTGAAGTCACGGCCTGGACGAATGGTACGATTTGCCGCGTAAACACGAA
CACTTGCAATTCTTCCGACATTTTGACGGACTCGCACGAAATCGGAACCACAGGAACTTCATGCTGTTTCGCGAACGCAAGTTCGTCCATGCACAATGTA
CTCTGCGCGTACCCGTCACTGAGCATACAGACAATCGCAGAAGCATTTTTCATCACCTCGAGCGATTCTTCGGATGCGCCACCTCCTTTCCGACCCAcgt
catcctcctcctcgctgcgCATGTACACGGTCATAAAGTTTTGCTCAATGCCACCACGTACACGCTCGGCAAATGCACGAAACACGGGATCAAATGAAAG
CACAACGTCGACGCATCCTCCTGCGACTTTGACTGCATGTTGCAACTCAGCTGATGCGCAGCACTCGACAGCACGACGCCCCTCACCATTTAGTGCGTAC
AGGTCTGCATTGCCTTGGACAAGCAGGGCTAACGCAGTATCTTTATATCCAAGTCGAAGCGCGATGTGGAGAGGGGTTTCCTCAATATCGTTGGGAACTA
TTTCATTGACGTCCGCCCCAAAACGGGCAAAGAGCTCCACACAGTCGCCGCGAAGCAGTCCGCCATCCACAGCAAACGCGACTGGGGTCATACCATCATG
ATCCAGCTGTAAATAATCTGCATCAACGGCAAGCAGTTCCTCTACTGCTGCACCATAGTTATGGCGAGCTGCCCAGTGCAGTGGCGTTCGCCCGTTACTG
TCCTTCGCATTGACGTCAGCACCGCGCTTCACCAACTCGCTTATCACACGGTGCCGTCCCAATATGGCTGCCCAGTGTAGTGGTGTGCGGCAGTGCACTC
CACGCTGAAACTCGCCTAGTGTATCTGGGCTAATTCCCCACGACAATAAAtgttgaacagcagcaagatttccagcagcggcagcttcatGCAATGGGGT
GAGTGCCACATCGGCACCCCATTCCTCCAGCACGGTAGCTAGTTCTCGACGACCAGAGAGCTGCGCACGTTGGAGCACAGTAGTGCTGGCGGCGTTGCCA
CAACCTGGCACTAGCAAGATATTGGCTCGATGATAAATAAGGCACTCCACGACGTCGGCCGAGTCTGCGAGGAAGACTGGTGTGACGCGCATGGATCGTG
AGAAAAAGCTAGACCGAGCCAAGATATCCAAGTTCGCTCCGTGTTTCACAAGGAGATCGATGACCTGCGTGTGGCCATGTAATGCTGCCACATGCAGGGG
CGCACCCAATACATGCGTCACTTTCTTCACGCGTACTTGGCAAAACTCGTAGAATAGCTCCAGATTGAACGCTGCGCCAGAAATTTTGTCGAGGAAGTTC
GGATTCAGACCTGCCTCCAGTAGCACTGACACGACCCTTACATCGCCAGCACGACACGCCACATGCAGCGGGTTGCGTGTCCGATGCGAGAACATCCAGC
AAAACAGTGAAGGTGTGGTGTACATGCGATTGAGTAGCAAATCCAGCTGCACTTTCGATCCAAGCACATGTTCTGCTCGCTCCAACAATttctccaccgc
tgcacAATTTCCActtgccgcagcagcatATAATGCACCGCGAAGTTGTCTCTCCACGGTTCGAGCAGTATTCTGCGTCGTTTGCCACGGATGCAGCTCC
TGATTCAGCGTCAAATAGGAATCCACATGATTCGACTGCAAGATCGGCGTGTTCACCCCAGTCGGAGCAGTGGCGTTCTTGTCGTCTGTagtatcagcag
cagcaccgcctgCAGCCAACGCTGTCGGAGCCACCGCCATCAACTCATCGTCTTCCAGTCCAACTCccagttgcagttgctggtgtgcACGAAGCTTGTC
AAACTGCTGCGTGTGCAGTGCGATTGTAAGGATGGCAAACAGCGTAGCGTATGACGTGGGGTCCGTCCAAATAGCCCACACGCCTTCCTCCGTGAGTTCT
CCAAATGCCCAATAGATACTCAACATGAGCACCACAATCCATGACAACGACACTGTTTGAATCACTACAATAGCTTCGAAAACTGCAAGAGCGAATGTGC
GTTCCAAAGTGACGCCAGGATCATCGTAAGTCAAGCGGGAGAGCGACAAGGAGCTGAGGGCACGAGGACCCAGTAGCTGCTCGCTTGTCGTCGCATTCGA
CGTTGACTCTTCGTCGTTTGGAGCACCGACCACACGCACGCGATAGAGCGGAACGAACGGCAGTGCCGCCAACCCCAACGACACGTTGAGCACCTGCAGG
CCGAGCCAAATATCCAGCACGAAACCTTGTTTGCTTGTGGAGAAAAGCAGCAGTTGAGAGCCCACTGAGAGCAGGGACGTAGATGCCAAGCGCCATGTGT
AGTACGAGTTCGACCACTGTAGATACGCGTCCGCACCCTTCCATTGACCGCTGCGGGAAGGAGGCggcagcggtggcggtggcgacgtATCGCCACTTGA
GCCACTTGCAGCCATCTTCTGATGTGCCTTGAAATATGGTAAGTCGTAAATCTTAGCTATTATTTGTAATCCAGTCAGTTTTGTCTGTAGTACTTGGGAT
TTGTATGGGCGCCGATCTCGTGCAGTGCCCTTAAAAACTGCGTACGCGGATTTTCTTACTTGCCCTCAGTATGTCTCAAATTCAGAGCGGTTGGGATGCT
GGCCGTTCTCGTGGAGGCCGCTAAAACCGCGTACGCCACTTTCCACCAGAACATCGATATCGTTGAAATCGATAATTTGATTTTATCGAATTTACAAGGG
TGCGATAATATCGGTTAAATCAAAAAATATTGTCAATTAATTTTGACAATAATTTTATAAAGCATCAAAAGACATGAACGCGATTGGCGGAATAGGTTTA
TAGCCAATAGCAATCGTCCGGCCCGTCTGCACGAAAGCAGCCAGAACCTCCGCAACACAGAAGTTGCGCTGTAGCAAAGCTCGCCCAACATTTTCACAGC
ATACGGCCAGACATCCAATCAACCGGCCAACGTTCAGAAGGAAGAACGCAGGACACGACGGTAGTGCACACGTCACAGGCGCTGCACTCTCTAGCAGCCC
CCACAGACATCTCCAGGAACCAGGCCCCACAGCATCAGACGCACAGTTCTCCCAGCAACACGCTGAGTTTTTGCCACCCTCGTACAGCCCAGTAGAAGAG
CAGAGAAACAGGTTTACAGGTCATGGCCAAGCGCATCCGAATGGCCAAGCAAGAAGCCGCCGTGCCAGCGCCCACAGGGCTCCCAGACGCAGCCAACACA
GCTCCGAAGGCGAAGGTGGCCACACCTGCCAACGCTGAAGGGAAGCACGTGATGCTGCCCGCGTTCCTGTCCAAGACGTACGAGATCTTCAGCATGCCCG
AGTTCGCGCACGTCTGCGGCTGGAACGCCAACGGAGACACCATCATCGTGTCGCAGCTCGAGGCCTTCgtggccatggtgctgcCGCGCTTCTTCAAGCA
CCGCAACTTCCCGTCCTTCGTGCGGCAGCTCAACCTCTACGGCTTCCAcaagacggtgctggacTCGAAGCGgctcgagttccagcaccCGTACTTTAAG
CGCGGAAGGCCGGAcctgctacaccacatcaagcgcaaggtgtccaacagcaaccaccacaaccaaCAGCTCGTGAGCACGTCACTTCAGGTGGGGTTGG
GAATGCAGGAAAACTGGGTTGAAGAATTGTAGGCTGATTTTGTGTTTTTGTTTACGTAGAATTCGAGGCTTGATGCGCATCGGGAGATCTCGGACACGCT
GCTTCgtgagatgaaggagctgcgtcaACGTAGCGACGCGATGGAGAAACGGCTGCGTGAAGTGGAGATTGACAACGCTGTACGGGCGACGTGGGGATTT
TTTGGGGTGTTTACACAAGGGTTCTGATGgtttttttgttttgtttttgcGATGACAGATTGTTCGTAGTGACAATCTGAAGCTGTGGAAGCATTTGGAG
GCTGCGAAGGACAAGCAGTTGATcatgcaggagaagatgaagaagatcatgtgGATTTTGTTCCAGATCTACCGCggaaagcagcagaaccttCCCAAAC
TCTCCAGCAACGATGGCACTAGCGCAGTCATCAGCGAAGAGTAAGTGTTGTAGCCATGCGATGCTGACTCATATTTTTGCAAAGCTGAGTATTCGATGTG
TGACTAACCGatttttgctgctttgtgGTATTTGCGATTCGTGTCTGCTTCCTGTTGGCTTCGATTTTTTTCTTTGACCTATTGGTAGCTACATCGACAA
CAGTATGCTTGGGCCAAAGGAGTTCCGTGACGTATTGCGGTTCTTAGCAATGGACGACCCCCCGCTATTACCCGGATCATCCGccaatgttgctgctgca
gcaccaggcTCGCGAAAACGGAAGTTTGTTGAAGTCCCTTCAGATGTTGGTGACGATCTTACTGCTGGAGGTACTCCTTACAAGCTAGATTCGCTTCTGC
TTTTTTCGCTTTGCAGTTCGGATGACCCCACTAACTTATTTTGCTGTTAGATGTAGAGCCATCTTCGGTTGTTGAAGTGCCTCACACCCTGGAGGAGACG
AACCCATATGCGATGACAGTACCGTCCAACACGCTTCCCGTGGTTCACCCAGATGGCGGGCAGAACAACGTCCTGAGCATCTTTTCGCCGATCAAAGCGG
GACACAACAGCATACCCAATATCGATCAGTTGAGCGGATTCCTTACGAATGGTGTGGACACGGCACCGACTGTATCTTCACCGACTGTATCAACAGCAAC
CGTACCGACACCGATTGTTTCATCCCCGACAGTGACGTCGCCAATTGTATCGACGGTATCGACGCCAAATGTATGCACACCGGTCGCCAACAACGGAAAT
CAGACACCGagtgaaaatgctgcagcttcaaatgGTGCTACAAGTGAATCATCAACGGACACACACAATCAACTGGCATTTctggacgaagagctgccTC
TACTACCAGACTCCGACCACTACAACTTCAATGACGGCGAGCAGGTACTATAATGCGTCCAGCGGTCTTGCTTCTCTGATTTTTGTTTGCTCGTGGACAG
TGTTGTAATGGCGTGCCTTTTTGTTTGGCTGTGTATTAGCAGGCAGTAATGAAGAAACTCGAAGATTTTGAGAcgtcgttgctggacgagtacgacgtCA
GCTGCCTCGACacgctgcttcagcaactAAAAAACTCCAACGGGGACAAACCAGCGGCTGTTTCAGTGCCAGATCCGGAAGAGGTCGTGGTGGGGTCAGG
CAATGCTTCGCCGCACGATGCATAATGCAGACTTAGTGGGCTGAACCAGCATCTATCTCGACTGTTAGAAGCCGGTGATGCCTGAGAAGACAACCCCACT
GAAGAAGCTACATATCCATGTACATGTCAAGCAAGTTACTGCGCGCGCGTGTTATCACTGGTGAAAGgtctgcagcgctgctgtAGTATGCCTGTTGCTC
CTCTCGCCGGCTGATAGACAAGCGTCGGTGACTTGCGTCTCCTCTTCCGGATAGAAACAGATCGAGTGCCCAAAAgtcaagaagcagatcaTGCGCAGCG
ATGGGAGCAGAACATAGCAGCATCCCGATCGATCGCGACGCGAAACCAAGAGGGACGGAGACGAGTTCGTACGAACAAACAGCCAACAGTTGATGCGATA
GGCATTCGACGGCAGCGAACGAGCGCTCCGATACGATGACGACCCATACACAAGGCTGTTTTTATTTATGCAGTGATGCGAGAATCGAGACaaccacaag
aagaagaaaaaaacaaGAAACAAAAATTGGTTTTCTACTAAGATGCACAGCACCGTTCATCGTTTAGATGTCTCCAATAGACTACGCAGTCGTTGgatct
ccttgtccttgcgGCCAAGCTCCAGTTGGGCCGTGGCAAAAAGAGTGGAGATGTTGCTCTCCAGTTGCTTGTTGGCTGCACCTAACTGTCGGTTCTGCTC
CTGCAACTGCGCCAGTTCATCTCGAAGTCgcttgttctccttctccacttgAGTCTTAAGATCCAGCgcctctttcttctccaaggcgctcgtggacgtg
tcCAAGTCGCCGTACAGGTCTTCCTCTGTGCTCATCGTTGTCAACTTTCAAGAGTGATCCCATACAAACTCCCAGCCATCAGTCCGGTTCGGAATTAACG
ATGGACTCGAGATGCACCAAGTTCTGGGAGGATGGCCAAGCGCTGGTGGCTGCTGTGTCTGGACCGGATAGCGCTGCTAGGATGGAGACAACGAAAAGAA
AGATATTCAAGGAGTTACGCACCATGAGTCGCTTCCTGCAGCGTAACCAAGGCCAGCGGTTCAGTGACGCAGCGCAAcagaagctcgtggactGTGTGGG
GCACTATGTGGGGCTGGGAAAACAGGGAGGCGTCATGCTTCCAGTGGCTGAGGCCACGTTCCAGACAGTCAAAGACGGACTCGCGATGCCGTTCAATGTC
ATCGGCACTAAACAGAAGAAGCGGCTGCTGAAATGGTACAATGAGCTCATTGCGATTGTCGGAGGAGACCCGgacgctgcaattgctggagaagttgttg
CTGAGCCGAGTATTGAGTGGAGTGTCATGGACATCGACGAAGACGGATTCCTGTCGCTCATGCAGGTGGAAACAGGTGAGACCAATGAGAGTTTtcaagt
gaagaagaagagcgcagAATACAAACGCATCAAGAAGGCTCTCGAGAACCACGAAGTCACAGTTGTGACCACTGGCGACAACATCGAGGAGATCCGAGTC
GAGGACGAGTAGATAGACGATAGAAAGCTGTTAGATCATAATTAAACGTGGCCAAAACGCATCGAGAGTTTTGAGGCCCGTCCAGTGCTGCGTGTACATG
ACGAAGACGCTCATTTAGAATGGGCTGGGGGTAGCAGCACCGTTCTTGTCGCGACTCTCACTCCACGCCTTGGCGATCGtgcgcttcatctcgtcgtcgc
cttcgtcgtaCATGTTCTGCAAAACAAAATAAAACATATTAGCGTATACATATTGGATTTTCACAACACGTTCACAAATGGATGCACCTTCATCATATCC
ATGATGCCCGCCGCTGGGTCACTCGTGTCGggtttgctgctcttgagcgGGTTCTTCGCCGTCAAGTTAATCCACGTATTatccttgtccttcttgtgca
ACGAGATCGTGACGCGATTCTTCTTGACGCGGAACGAGCTCTTGGCAGGAtcaatctccttctccaagtgctgcttgaccagtctgcaccagcacaacag
caacaacaatttcATCAGTATCCTCCCCTCATCTCTCAATGTCCAAACAACTTCCAACACACCGGTAGTTCTTGTTGCCCAGTCCAATAATCTGTCACAA
AACCAACAAAAACCATTAACCACTCATCTAACAAACCTCCCTCTTGTTAAGAACCGCTTGCCCCACCTTAAGATCGAACGACGTCTTGGTGAAGTGGCAC
GTCACGTTCTCCTTGGGTAAATCCCCGACCCCATCGACACCCGACATGACGTAGaccgccaccttctgcttGCCGTAGCCGTCGTCCTCCCATCCGAAGC
GGCTGATCTCTGTGAAGGTCGTGAGGTCGTCGCTggtcgctggacgaggcgtcgccaccttcacaggcgtctccagcacctccttgggcgtctcctgctg
cggctccgcggccgccagcgccttttgtttgcgctgcagcagcagctccaggtcgCGGCGGTTGCCGTCCGTCTTGGtctgcgccagcagcgtctgcagc
tcagcGACTTCTGCTGCCAGAGCTTCCGTAGTGCCTGCCATTGTCGTCTCTTATTAAGGGGTTGCGATCCAATTGAAAAGTAACGAAAACAAG