Description :
From Genome Similarity Track
Location :
contig_109:88550- 91209
Transcript NameFunction/comments
g13687.t1hypothetical protein
g13688.t1hypothetical protein

Sequence
2659 bases(100 bases per row)
TGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGCGGCAGCTCACGCAAGAGAAGACGCTAGAGCTGGGGCT
CGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGCGGCAGCTCACGCAAGAGAAGACGCTAGAGCTGGCACAACTACAG
CGGGACTACGTCCAGGCGTAGTACGCCGCATTGCAGACCCCTCGAGAGGGTGGTCGGACCAACGGTATTGGACATGCTCACGGGCGAATACAAGGACGGC
GGGAAGTTAGCTGTTCTGCCCGCGGTAGCAGAGCTACTGGAACTCGAAGAGCTCTCGTATGTCGAGTTTCTCGACTCTCTGAAGGCGGGCGTGCTCGAGG
AGATGGTCCTGATCCGACGCGAATTCGATTCGATCGAGCTCAACACCTCCTCGGTCATGGACCCCGAGGTGTTGGAAGACGAGAGGACCTCCTCGCGGCA
GAAACGATATGGCGCGGCCATTTTGAAAGACCCGTCGGATCCGTACTACCCCCTTTTGAAGGAGTTCTCGGATGTGGTCAGCGATAACCCACCGTCGGTG
TTACCTCCAGATCGAGGTGTGCGACACGAGATCGATTTGGTGCCGGGCACCAAATATTGCACCACGCGCCAATGGCCACTACCGAAGGAGCAAGTCGATG
TGATCGACGCATTCTTCGCGGCGAAATATGCCGCGGGCATGGTGCGCGAGTCAAAGTCGCCGCACTCGTCTCCGACGTTTTGCGTGCGTAAACCCAATGG
GAAGTGGCGTATGGTACATGCGTTCAACAAGTTGAATGCAGCAACCATCCCGGCGTCCACGCCAATCCCTCGCAAGGACGTGTTACAGAACAACATGGCG
GGCTGCACCATCTTCAGTGCACTCGACATGGTCGATGGCTACTATCAGCTGCTGATGCGGGAATCAGACGTCCCGCTCACAGCGGTGAGCACACCCAGCG
GGATGCTGTGGGAATGGCTCGTGATGCCCCAGGGGCTGTCGAACGCACCAGCCACGTTCAATCGATTGGTGACTCAACTCTTCCGGCCGATGCGGCAGTT
CGTACAGACGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGACAAGACGGCTGTCGAAGTGCACGTTAACCACCTCCGCGAGGTATTGATG
TGCATGCGCGAGAATCGCTTGTATGCGAACATCAACAAGTGTATCTTCGGAGCCGAGGAGATTCCCTTCTTGGGATGTTTCCTTGGCAAGGATGGTGTCC
GTGCGGACCCTGAGAAGATATGCGCGATCGCACAATGGCCAGTGCCAGTATCCCAGAAGGACTTGCGCAAGTGGCTTGGCCTTGCCAACTACTTACACAA
GTACAGCGCCAACTACGCTGAGATGGCACGGCCACTGACGAACCTCTTAAAGAAGGAGGCGGAATGGTCGTGGAACGATGAAGCCCAGCAGGCTTTCGAG
GCAATCAAAAGCAGCCTGCAGAGCGCTCCGATTTTGGCTTTGCCCGACGATGATCGTCCTTCAGTGTGGTATGCGACGCATCCGACTTCGCCATAGGCTG
TGCCCTGCTGCAGGTCGATGCCGATGGCAGAGAACGGGTAGTATCTTTCCAGTCGCGCCAACTCAAGGCGGCTGAAAAGAACTACCCTGTCCATGACAAG
GAGCTTCTGGCGATGAAGTACGCGCTCGTAAAGTTTCGGGTACACCTGCTTGGCAGCGAACCCTTCGTGATCTACACAGATCATGCGTCTTTGCGGACAG
CGACGTCGTCGCCCCACCTCTCCAGCGTATGGCGAGGTGGCTCTCCTTCTTTGCGGAGTATAACTTCACGGTGGAGTACAAACCAGGGAAGCAGAACGTC
CTCGCGGACGCGTTGTCCCGGCGCCCGGACTATGAGCTGGCGCACGTTGCGTATCTCGAGTCCCCACTCTATGAGCTGCTACGCGAGGCGTACGCAGAGG
ATGGCGATCTCGCCGATCTCGTAACTTCACTGAAGGTGCCTGAAAAGGCTGTGAAACTCACAGCTCGGCAGCGCTCACGGTTGCACCGCTACTCACTAGC
GGACGGTCTCCTCTACTATCAGGTAGACGAAAGCGACGAGCCCCGTATCGTGGTTCCCAACGACGAGAACTTACGTCATCGAGTCCTCTACGAGGCACAC
GACACGCCGCTCAGCGGCATCTTGGCCGAGAGAAGACGTATACGTCTGTGGCGCGCAACTTCTGGTGGCCACATATGTATAAGTGGGTGCGCACGTACGT
GCAGACGTGTGAGACGTGCAACGCGTGAAGCCCGCCCCATCGTCGTCGGCTCCATTGATGAGCTTGCCGGTGCCGGCTGACTGTTGGCGCTCGGTGAGCA
TGGATTTCATCTTTGAGCTTCCGGCGGACACGCGCGGCCACACTGGCATCTTGGTCTTCGTCTGCCGACTGAGCAAGATGGTGCGGCTTGTCGCGGTGAA
GAAGAGCGTGACGGCGCCGCAAGCGGCACAGCTCTTCGTCGATAATGTCTTTCGACACCATGGCCTCCCGGAGGCGTTCGTGAGTGATCGAGATCCGCGC
TTTGTGTCACACTTTTGGACACACTTGTTCCGTCTTCTCGGTACGAGATTGGACATGTC