Description :
From Genome Similarity Track
Location :
contig_109:88542- 91201
Transcript NameFunction/comments
g13170.t1hypothetical protein
g13171.t1AAV92918.1 pol protein [Phytophthora infestans

Sequence
2659 bases(100 bases per row)
CGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGCGGCAGCTCACGCAAGAGAAGACGCTAGA
GCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGCGGCAGCTCACGCAAGAGAAGACGCTAGAGCTGGCA
CAACTACAGCGGGACTACGTCCAGGCGTAGTACGCCGCATTGCAGACCCCTCGAGAGGGTGGTCGGACCAACGGTATTGGACATGCTCACGGGCGAATAC
AAGGACGGCGGGAAGTTAGCTGTTCTGCCCGCGGTAGCAGAGCTACTGGAACTCGAAGAGCTCTCGTATGTCGAGTTTCTCGACTCTCTGAAGGCGGGCG
TGCTCGAGGAGATGGTCCTGATCCGACGCGAATTCGATTCGATCGAGCTCAACACCTCCTCGGTCATGGACCCCGAGGTGTTGGAAGACGAGAGGACCTC
CTCGCGGCAGAAACGATATGGCGCGGCCATTTTGAAAGACCCGTCGGATCCGTACTACCCCCTTTTGAAGGAGTTCTCGGATGTGGTCAGCGATAACCCA
CCGTCGGTGTTACCTCCAGATCGAGGTGTGCGACACGAGATCGATTTGGTGCCGGGCACCAAATATTGCACCACGCGCCAATGGCCACTACCGAAGGAGC
AAGTCGATGTGATCGACGCATTCTTCGCGGCGAAATATGCCGCGGGCATGGTGCGCGAGTCAAAGTCGCCGCACTCGTCTCCGACGTTTTGCGTGCGTAA
ACCCAATGGGAAGTGGCGTATGGTACATGCGTTCAACAAGTTGAATGCAGCAACCATCCCGGCGTCCACGCCAATCCCTCGCAAGGACGTGTTACAGAAC
AACATGGCGGGCTGCACCATCTTCAGTGCACTCGACATGGTCGATGGCTACTATCAGCTGCTGATGCGGGAATCAGACGTCCCGCTCACAGCGGTGAGCA
CACCCAGCGGGATGCTGTGGGAATGGCTCGTGATGCCCCAGGGGCTGTCGAACGCACCAGCCACGTTCAATCGATTGGTGACTCAACTCTTCCGGCCGAT
GCGGCAGTTCGTACAGACGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGACAAGACGGCTGTCGAAGTGCACGTTAACCACCTCCGCGAG
GTATTGATGTGCATGCGCGAGAATCGCTTGTATGCGAACATCAACAAGTGTATCTTCGGAGCCGAGGAGATTCCCTTCTTGGGATGTTTCCTTGGCAAGG
ATGGTGTCCGTGCGGACCCTGAGAAGATATGCGCGATCGCACAATGGCCAGTGCCAGTATCCCAGAAGGACTTGCGCAAGTGGCTTGGCCTTGCCAACTA
CTTACACAAGTACAGCGCCAACTACGCTGAGATGGCACGGCCACTGACGAACCTCTTAAAGAAGGAGGCGGAATGGTCGTGGAACGATGAAGCCCAGCAG
GCTTTCGAGGCAATCAAAAGCAGCCTGCAGAGCGCTCCGATTTTGGCTTTGCCCGACGATGATCGTCCTTCAGTGTGGTATGCGACGCATCCGACTTCGC
CATAGGCTGTGCCCTGCTGCAGGTCGATGCCGATGGCAGAGAACGGGTAGTATCTTTCCAGTCGCGCCAACTCAAGGCGGCTGAAAAGAACTACCCTGTC
CATGACAAGGAGCTTCTGGCGATGAAGTACGCGCTCGTAAAGTTTCGGGTACACCTGCTTGGCAGCGAACCCTTCGTGATCTACACAGATCATGCGTCTT
TGCGGACAGCGACGTCGTCGCCCCACCTCTCCAGCGTATGGCGAGGTGGCTCTCCTTCTTTGCGGAGTATAACTTCACGGTGGAGTACAAACCAGGGAAG
CAGAACGTCCTCGCGGACGCGTTGTCCCGGCGCCCGGACTATGAGCTGGCGCACGTTGCGTATCTCGAGTCCCCACTCTATGAGCTGCTACGCGAGGCGT
ACGCAGAGGATGGCGATCTCGCCGATCTCGTAACTTCACTGAAGGTGCCTGAAAAGGCTGTGAAACTCACAGCTCGGCAGCGCTCACGGTTGCACCGCTA
CTCACTAGCGGACGGTCTCCTCTACTATCAGGTAGACGAAAGCGACGAGCCCCGTATCGTGGTTCCCAACGACGAGAACTTACGTCATCGAGTCCTCTAC
GAGGCACACGACACGCCGCTCAGCGGCATCTTGGCCGAGAGAAGACGTATACGTCTGTGGCGCGCAACTTCTGGTGGCCACATATGTATAAGTGGGTGCG
CACGTACGTGCAGACGTGTGAGACGTGCAACGCGTGAAGCCCGCCCCATCGTCGTCGGCTCCATTGATGAGCTTGCCGGTGCCGGCTGACTGTTGGCGCT
CGGTGAGCATGGATTTCATCTTTGAGCTTCCGGCGGACACGCGCGGCCACACTGGCATCTTGGTCTTCGTCTGCCGACTGAGCAAGATGGTGCGGCTTGT
CGCGGTGAAGAAGAGCGTGACGGCGCCGCAAGCGGCACAGCTCTTCGTCGATAATGTCTTTCGACACCATGGCCTCCCGGAGGCGTTCGTGAGTGATCGA
GATCCGCGCTTTGTGTCACACTTTTGGACACACTTGTTCCGTCTTCTCGGTACGAGATT