Description :
From Genome Similarity Track
Location :
Scaffold_12:88532- 93560
Transcript NameFunction/comments
Phyke_g2288hypothetical protein PHYSODRAFT_323353

Sequence
5028 bases(100 bases per row)
CCATACACGTCCACTTATTGTCGCTGTAAAGCGACGGAGTGCCAAAACGAGTATCCAGGAGAATCCAACGTAAATACGTGCGAAAGCAAGCTTTCCGATG
GTTCCTGTCCGTCAGGATACAAAACGTGTGTATCAACGGATTCCTACAAGGTTACGACTTCGACAGTCACCCCTAACAGTGTTTCAGAAGCATCGTTCAC
GCTCTTGGCTTCAGACATCATCGGAGCATTTTACAACCTGGGAGAGGAAGACCCAATAGCCCTCAGTAACAAGTGGTGGATCACAATTTCACTTCCAACA
GGATGGAGATTCGTTGCATGGGAAAATACGGCAGTTGATGTGACGCTACGGGACGACGATGGAACAGTTGCTACCGCTGAACGTGTGCGTAGTTGTGAAG
ATGTGACGGACGGCAAGAATTGCGATGTTCAAAGCACACACCGCTATGGTTTCGTAGACGTTATGGATCTTCTTGACGGGCGAGGGGATTTGATGACATC
CAACTCGAGGGGCCCAATGTCGTTTGTTCTCTCAAAGAGTATCGTCACTggcagcagttcgtccaATAGCCTTGTTGGGGTTAGCGTGTCGTTATCCTAC
GAAACGACGACTGGCACTCTCAAATCTGCGGCCACTTCCAGACGTATGCAGGAACTTGTCTTGGCTACTGATGGTTCTGCTTCGCCTGGATCGTCTGACG
ACTTAAGTGCGTTAACTCTCGCAACAATGGATCTACCCCTCATTCAGGAGGGCCGTTTGGATGCCTCGCTGTTGTGGATGGAGGAAGATTCTGAGGTTCT
CATGCTGTCGTTCTCGACGTCAACCATTGTTGGCCCCAATTCAGACAATCCAAAAGTCTGTGTCGATTTGCGTTCTTCCTACTGTGCAAGCAAAGGACGC
ATGCCCAACTCTACTGTGAATTTCGGGAGTTCTTCGTTTGCCTCGTACGTCCAAGGCGGTAATCCGTTCCTCAATCTGTACGCTGACCCAGGTGACACCA
ACTTGAACGTTGAGAGCGACAACACGACATACTTCTGCGTGACGGATCTCCTCCCGTCAGGTGTTAAAACTAACGACACATGGGAGATCAGGACGACCTT
CACATTCCAGATTCAGATCACAGCTGTGTCCTGGTCTGGTGACGAAGGAGCAGAGGGTGACTACTCGAGTGGATTCCGTCTACCCATACTCGGGGAAGTT
ATCTTGCTGGACGACAACAGTGTGATGGGGACGGATTGCGCACAGACTTTGGTGCACGGGAAGACATACTCAAAATACACCCTGAGTGTGTACAGCGTAA
TGTCTATCACATTCTTCGCTGTTGCTCTCGCCGGTGCTGTTCTCGTGACACGGATGAACGGCATTTCTTTCTCAAGACCAACGTTCTACAATGATATGAC
ATCAATCTCGGTGATGATGGTCTTCGTGTTGTGCATTGTCGGCAACGCGATTTGGATCAGTGTGTCATCGAAGTCGTCATCGGCAGGTGGAACGGATATC
TACTATCTGTTGTACGCAATTTCTGTCTGCTTCAcgtggacgatgatgacatcAGTGTGCTTCCACTGGGGCACTGTGCTCTTCCACGATGTCACTCACT
CATggcgcttgatcttgtttGTCGTCTATGTGATTTTCAATGTGGCCTTCTATGGCGTACAGCTTTTCGGGGTTGTAAGTATGACAGACTTGTACAAGTG
TGCGTATGACGACTATCTGAAGAACCCCTTCTACACCATGCGGCTGTGCTCCAACGACTACTGCCCGGATCTGCAGCCTGCTCAGTGGAAGTATGCCGTG
AACGATGTGTGCAAAGACGTCAGCTACTCGAATTGGTTCTTCCCACTTCAGCAAACGGCTGAACTTCTCATATTTTTGACGTCAGTGGTGTTGCTCATTT
TGGGCACGTTCGTGATTCAACGTGGTGTGAGGCTTATTGACCAGTCTGGAGATATTTTTGACGACCACGTGgtcaaggtgatgaagaaatcacTGATCAC
GTACCTGGTTGTGATCTTATCGATTGCTCTAGTGCTCGGTACATCGTGCATTATGAATTCCATCCTTCACTGGAAGAATTGGACAATCAACTCCGTCGTG
TGGTATATCTTCTGCATGTGGCTCCCAACTCTAGTTCCGCCAGTCGGATTTTTACTGTTGCAATGGAACCCACGACTGCATGGCATGAATTGGAATCCTT
CATTGCACGTGAAGGACCCACAGCTACTTCACCGCACGATGTCAAGCATTTCGGATAAAGTGGAGAGTGGGAAGTACGCTGTTCCTTTAAATGGCACTGG
GTTGAGTGATGGCTGGGCAGGCATCTTGCAATTCCCGGACACGGAATACAACCCAATTGGCCAGGATAGTGTGGATGGCACGCAAAATGTTTTGGCACTA
GCCGTGCAGCTCGTTTCGCCAGTGCCAATCACACACGCGTGTTTCGTCGAGTTGTACGTCGCGGAGAATAGTTCTGCTGATTCTGGTGAGAATGACGTAA
CGGGCGAAGACCATTATGAAGATCTTCCCGTACTCAGCTACCGCCGTTCATCAATCAGCACGTTCATCGAGAGTGGGTTGCACCAAGAAGGAATTCTTAG
CCGCCGCAGCAGTCAGTCACTGTCGGTGCTAGGTACCCCCGCCGTTCCAACGCCACTTCCTGTCTCCAACCCAGGGGTGAAATGGTCACGAGTGGGTTTT
ACAGAGACAGTGCTACCGACGCTGGTGACTGGGAGCTCCGAAAATGGCGGTGGGGCTGTGATGCAAATCGCCACTTTCCTGTCAGTGCTTCAGATTCCTG
TGATGCCTGCCAACCCTCTTCTCCGCTTCGTTGTATATGAAATCCCGGAAAAGGCCTCTTCACCGTCGTCTGAAGGTGATCTGCGTGCCTCCCGCCAGTT
GATGCGTGCATCTTCCAGGCAATTGGATGAACGCGCTGCAAGTGCTCGGGTGTCTGGAATGGGAATGGCACCCCCCTCGCGGCCAAAGGTCTTCTGCGAG
TTTTCATGTGCTTGTGGTGATATGCTGGTGGCAGATGAGGTTAACCTAGTGGCTCGGCAAGTTTCGCACCGCAATCGATCGCCTATTCCAACAGTTCTCA
GCGATGGGACTGGCGCCGAATCCCCATCTATAGCAGCTACAAGAGCTCCCACTCCTGAAATTGATCCTTCGGCTCCTCGTTTGCGCGTCAAGTCCATGAC
TGTCTCGCCGCGACAGTTGAAGGAGACCCCTGGATTCTACATCACGAAGAGTTTTCAGTTTGCTGAGGGGGATGAAATGGTGATTGAGGACATGACTGAG
AGCCCGCTTACGAATGAACTGCCGCGTCAATACCTGGAATTGTTGGTTTCAGAGCGCGCGGAAGACCTTGCCCGTGCGCAAGCCGAAGCATCAGACTATG
AACTGAGGGTTAAGAGCGGGCTTGTTGGCAATCTCTACGACAACCTGATCGAGCAGATACAGGGCGAAAACAACCAGAATGTGGTTCAGACGTGGCTAAA
TGATCGTGTTCAGCAGCGCAAAATGTATGTCGAGGCGTTGCGTGAATGCTACCAGGTGTGCATTGATCGCGCTGACCAAGGTGTTAATTTCAAGGCCAGT
ACCGAAAAGAAGAGCCTCGTATTGCGATTCCTGCCCATTAATTTGCACGTGCAAGATATCTGGGTAGGGCTAACGGCTGATTTGCGCTCGCAACGTTCCA
GGCGCACGTCACCAAACGTAAAGGTATATCCAACGGTGACGGTGGGCGCATTTTCTGCGCACTGTTTCAAATTCCGACATGGCGGTAGTATTCTGAGTTT
GCGTTCGTCGTTGCAGAAGCGCTCGTTGTCTCGAATTGAGAGTGACGTGTCGGATAAAAGCGGCAGCGAACAGATAGACTGGGGCAATGTCGACGTGCGT
AGTACAGAAGAAACACGATGGCACCTCACGACGCGGTTTGATATGTGTTTCTCGCAGGCATTGACGACATTGGTCACGTCATTTTGCCGGCAGCTGGAGA
TCGCGTTACAGAATCCGATTGACAGCCGGTTCCTGCAGACGGCCGACTCCATCGGCTTCTTGTTCCAAGTTGAATCGTTGTTGTCCACACAGGGCAAGGA
AATCGGCATGCTTGAGGActtttctgctgctgtggatgcGCTCAAGCATGTGACGATCGTGCTGgacacatcaccaccatcgcACCTTCCTTCAACACTG
CTCAACTTGCACATGAAAAACACAACTCTGCCTGGTGTTGTGTCTGTACGTTTGAGCAAGGGATCTACCAGGGGGACATTTACCGTGGCGATCGGGGTTC
GTTGCTCAGAGGACGTACTGGACACTATTCCTACGAACCTCCGATCTGGCAGCGCGATCTCCGTCACACCTGTGATTTTCACACAAGGTATCAACGAGAT
GCAGACATTGGCTAACAACGCGAGTagcaagaagacgacgctgcaAGATATCATCAACCGCAAGAGCTTCGTCGTGCTGAGGCATTACGTTGAAAAGTAC
AAGCAGCTGGCGACGCAATGGGTACGTTACAAGTCGACGCCACCTCGATCTATGCTCATTCGTTTACTGATATTGTATTTTTCTTTGTTGCAACCACAGC
CGGACACAGTACCAACACCGATGAGTACAATTGCGCCTCTTTTGGAGTCGTTAGAGGACCGGATCGCCGCGGCCAGCAAGCGGCAGGTAGTGAAGTCGAA
GCACCCGCAGATCATTCAGGAGGGTTCACGACTGTGTCGTCTGTTGGGTGGTGGCCGCGTGACATCGTGCAAGAGTGCCAAGGACCGCACGGGGATGTCG
GTGACATTGGAGCAAGTTCGGTTGTTGAGTGAGAACCACGGTCTCCCGGAGGAGTTTGCGGTTCGAACGGTCTCGACCATGCGTAGCAACGGCACCCGTC
TGGAGAACGCACTCAAAAATACGGGCAAGCGTCAGTACGCTTTCAATGGTTTGCAGCGTTCGCTGCTTCCAGACGAGTACAAGTGTCCCGAGGGCACATA
CGGCCGTGGCAATGTGAGCTAAAGTAGC