Description :
From Genome Similarity Track
Location :
Scaffold_97:885- 3771
Transcript NameFunction/comments
Phyke_g4222conserved hypothetical protein

Sequence
2886 bases(100 bases per row)
ATGCGGGAGCAGTGGGAAGCTGCTCAGGCGGGGCTGCGCGTGTTCTTGGACGAGGACAATGAGTACGTCCAATTCCTGGCGGATGTCGAGGAGCATCTCG
CGCTCAAACTGCGCTTTACCCAATGTTCGAGAGTCGGAGGTCTCGTGGAAAAAGTTGCCTTCGATCGGTTTGTTGAGACTCTTCCGCAGCTCCAGTCCTT
CCACATCTTGTTCCAAGGTAAATTGAAGCAACTGACAAATCTTCCAGAGAAAAGAGGAGCAGCTATCGCTCGTGGGAAGTGCAACATGCTGGTGGAAGTG
ATGGCGGACATGCTCAGCGTCCTACGCGTCCCATACGCTCAGCTATTCAGCAGAAGTGAAGCTACGCAGACAGCACTGGAGCAAGTTCTATCACCCAAGG
ACAAGGGCTGGGATGGAGATCTACTGGAGAATTTTTTGATGAACCAGAAGTTAACTGCAGAGGAGCTGGTTGGGCGCCCGTTGCAGCGTTTTaacgcagt
ggtggagtTTGTTGAAGCATTGAGCACCACACTAGTCAACCCTTTAGAGGATggtgccatcagcaacaatAGTGATGCTAGTATAGATGACCGAGAGAAT
TTTGCTCCGAGGTTGATGCACATCGCCCAGGAAAACAAACACTATGTCTATTTTGTCAAGGCAGATGCTCGCGCGGAGAGAGAATTGATTGTATTGCAGA
CCTGCTTCCAGGGTGAGGGGGCGGACATATTCCGTGATTTATCCAAAAACAAGTTGCTACTACAAGGAGAAGTGATGGTTTCTCGACTGGGAGGCCACAA
TAACGCCACCAAAGTTAGTTCTACAGATGTGCATACGGCTGGACAATTTGCACAGACAGAGATGCTGTATGTTCATTGTTTTGAGGACGGGACGCTGGTT
TGCAGCAATCGACAAGATACAGAGTCCGGAGATTGTTTCACGATAAAAAATCGTCTCCAGTTGAAGCACGATGCTGTTTTCTTAGAACCCCTCCCTGCCA
GTGTGCAAATGCTCTCGTCATTCGATGAAATCCGTGCTTCTGCGTTGATCATGCAAGACAGCACACTCATATTGGTGTTTGAAGACGCGACAGACAATCA
GCGGTGGGCCGATACCATTGGGGGGTTCCTGGAAATGAATGGGACTCGGAGTGATGAGCTGTATAAGGTTCGAACTCTTGACGACCTTCCTATTCCCGAG
GAAATCGCAGCTCAATGTGGAGATAGCGACAAACCACTGGCCGAGTTCCCGTCCTTTTACGATGATTGCCTTCCCGGTATTTTCTGGATGACACCTACAA
CTGATAACCGAGCGCACAGCTTAGAATTAAGCAAGGATCGGTGGGAGCTAGTGGAGCTTGTCTTTCTCGCGCGATGGCTTTTTATTTTCAAGCTCGACGG
ATGGAAAGGTCATACGGTTTTGCATCATTTCGATACAAGTTCGCCGGAGATGGATATTAGTGAGCAGCCACGAGGGGAAAAAGAGTGGAGCTTAGTTATT
TCTTGCGGCGACGTAGGTGGGATCACGCTCGTATCTAAAAAACGCACAAGGATTGACTTTTGGTTTGATCAAGTGTCGAAAGCAGTCGAATGTGGCAAGA
TTGCTGCCAGGCGAGCGGAGAGTGAGGAAAGGGAACATCGAGAGATGGAAGCCGAGGAAAGGGAGCGGAAAGAGATGGAAGTCGAGGAGATCCACGCACA
AGATCATGGCAACAAGAGGGGTGTTGAGGCACCAGGTAGCGGTGGtgtcaagaagaaaagaaagCGCAACGCACTGCCCACCGACGACAAAGGCCTCGGA
atgcagacgatggaggGGCAACAAGCGACATCTAATCCGAGTCCTGCACGCTCTAATGGATCAAAGCCAGATGACAAGACTGATGAAGAGTGTGGTGACT
TGGATCAGAATTTCTTAGCGGCCTGCAAGGAGGACCAAAAGGCTACTGCGCGTCCCTCACGAAAGAAATCTAGACGTTTATCTGACAGACCGGGGCTGAG
CACGACTTCTAATGTCGTTGACGAAGAAAAAGGACGTAATGCCTTTGCTTCACCAGTCGTGAAAACCCCGAAGAGGAAGTGGCTGAAGCGTAAGTCGGAC
GACCCCGATGACACTGCCCTGGTAGAAACGCAGCCATGCCCAACCGCCCCAACAGATGAATCGATGAGCGAGATTGACCCTACTCAAGCGTCCGTGAATG
AGGCGACTGAAGTAGACGAGCCTAAAGACCAACAAATACGGATCATTCTCACGGGTGTTGAGATCACTCCTGCAATCCGGAAGAAAATTGATGCCGTCGT
GGGCGCAGTCTATGAAGAAGACATTGAGAAGGCGACGCATGTTCTAGCTCCTAAAAACCAACTGAAGCGCAcggtgaagctgctgtgcGGAATCTCGCGT
TGTGTCCACATCTTAGATGTGCGATGGCTAGATGAATCAGCGCGCGTTGGTGTCCCCGTCTACGAGCGAACACACTGTTTGAAAGATGCCAAGGCTGAGG
CGAAGTGGAATTTTGACCTGACGAAGACCATGTACGACTTTTCACCAGCGCAGCGGCGAGAACTGTTTACAGGGCAGCAAGTCTTCATCACAAGCCACAA
GTCAGTGCTCCCACCTGTAAGAGACTTGGTGAAAATCGTGGAATGTGCCGGTGGAAAAGCAGTGACCAAGGGCACGGCAGAGCCAGACGACCTGGTGATC
ACCAGTGATGCCGCGATGACCACCGCCTCTGTGCGAAAAGCGTTAGCGCAGGCGAACCCGAAGCGAATCTACTCCCCCGAGCTGATTTTGAGCGGCAttc
tacagcagcacattgaTCTTGACAAGAACCACCTCGAGCGAGTAGACGGTGGAAATCGGCGGCGTAGGTAGGTAGATAGACAAGCA