Description :
From Genome Similarity Track
Location :
Scaffold_204:885- 2738
Transcript NameFunction/comments
Physo_144585reverse transcriptase

Sequence
1853 bases(100 bases per row)
CCGCCTCGTGTCACATCCGACATCGCAATCGGATGTGCATTGATGCAGCACGATCACGAGGGTCGCGATCGTGTGATCTACTACCAATCGCGTCAGATGA
AGCCAGCTGAGCGCAACTACCCGGTGCATGACAAGGAACTCCTTGCCATGAAGTACGTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACCCGTC
GCTGCGGACAGCTGTGAAGTCGCCGCACATTTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAAGCCGGGTTGAGTACAAACCCGGAAG
ACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCATGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACG
TCGTCGCTGTTAGACGACGTGAAGGTCCCGTACGCGCACGACTCGGACGCGGACGCGGACGCGAAGCTCTTGCTCGCCTATGGCTCAGCACCTTCTGACA
AAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTTTACTCTACAGTGCAGTTGACGACAACGCGGAC
CGCGTTGTCGTGCCCAATGACCATGACCTTCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGTATCCGGACCGTGAGAAGACATATC
TTCTTCTCACGCGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGAGTGAAGCCTGCGCCTTT
CGCGCAGGCTCATTTGCATCACTGCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGAACAGCCAGGGGAACA
CGGGCGTTGTGGTCTTTGTTGACCGCTTTAGCAAGATGGTACATCTTGCGGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGA
CATGGTGTTCAAACACCATGACATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACCCTTCTTGGG
AGTCAACTTTCGATGTCGGCTGCGGACCATCCGCAGACGGACGAGCAGGGCAGACCGAGCGCGTGAACCGCGTACTCGTAGACGTGCTTAAGAGCTACGC
TCACTGGAGCGAGTGCCTGCCGATGGCAGCGTTCGCCATCAACAACTCGGTACATGTCTCGATCGAGCATACACCGTTTTGCGTGAATGCCATCAGGCAC
CCACGCCCCCCCGAGTCTACGCGGGATGGTGGCTCCTTCCTTAAATGGGGGGGGGGATCTCCGACTGCAACGCAGCAGCCGAAGACTGCCGCTGACACTT
GCACAGTGTCAGTCGCGACCACGCGCAAGAAGAACAAGAAACACGGATCTGTGCAGGGCACAGACACCGCCAACATGGACGCAGTGGCCGGGCCTACTGC
TGGCAACGAGCTGAACTTGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAACCGTCGTTCGGTTTTTCCAAGACGCTATTGCAGCTTCTGTC
GGTCGACAGAAGCTGAACGCAGACAACGTTGGCAGGGGTAACACAGATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCTACTCAAAACCTGCCTAAAC
ATGCCGTTTACAACTTCGGGGCAAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACTGTGCTGCCACGGCACGGCAACGCCTACACACTGGACATACC
GTCTCGTATGCGCCTCCATTCGACGTTTTACGTCAGACGGCTGAAGCCATACG