Description :
From Genome Similarity Track
Location :
Scaffold_485:8849- 11550
Sequence
2701 bases(100 bases per row)
NNNNNNNNNNAAATTCCTGTAAATGCACCACAATTGGGGTTCGCTTCATCCACCTATGCTTCATCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCAATTTTAGCTTCGATATGTGCACAAGCGGAAATAATCGGTATGGTTTTACTTCCACTTCCAGCCGTACTGCATGTTCCCCACACTTCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAACTTAAGTGTTGCTTCCAACGTCGATCGCAGGTCCCATACGTAAATAAGAT
AGAACGGAGTATCACCGCAACCTTGGTCTTGCGCTGTATTGATGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTCATACTTGTGAGAGAAATTCGACATTAGCACAGGCTCGTGATCATGACGACCAGATTCGCTAGCC
CCAAATCGCCGGAAGACGCANNNNNNNNNNAATTGTTTGGACCGTTATCGACGAGCTCGCCTTAGCGATATTGTAGCCAGAAAATTAATCACCCAAAGAA
GCAATTTAGTATTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTTGATGACCATCTTCCATACTTAGGTGGTAATGTGTAGAATATCATCTTGAAG
CAGCTCCGCGATCACCAGGCGAACGAGCTCAGCACGATCATCGAGATTTGTAACCAATCGCGGGCGAAAATACAACAGTCCGTCTTTATCTAACACGTAG
TCTGAAGCATTCACGGAATTACTTTTGCTTCAACAGCACCNNNNNNNNNNACAGTCCGTCTTAATCTAACACGTAGACTTAAGCAATCGCGGCACTTACT
TTTGCTTCAACAGCACCCAGCTCAGTTACATCTCCGACTATGTAAAGCCAGGTTAGCGATCCTAATTTCTTCGTCTTGCGCCTGTTTGATACGGTCGAGT
CGCATCTCCTGTACTACGTCTTCTTGTATATGGGTAAACGCTTCACGCCTTCGCATTGTCGATCGTGTAATCGCTGCCATCTTGATNNNNNNNNNNTGTA
TTATGGATAAACGCCTCACGCCTTCACATTGTTGATCGTGTAATCGCCGCCATCTTGATCNNNNNNNNNNTCATACCAAAGACCTTTTACAGCTGTAAAG
AGGTGCTAGCCAGTCGATCCGCACTTTGATACCAATCGCGCTTAACGTATAAACTCATGTGTCGGCCACGACCTAAGTCGATCTAGGACTTTGAAATGCA
GTAATTGTAGTCCTGGTGCCTTGAAATCAATCTCACCCCGCATCTGCCTGACGACTAGATTGGAATCATCACAGATGACAACTCGCCCCCTTGTCTGTTT
CGCTAGNNNNNNNNNNTGAACTCATGTATCGGTCACGACCTAAGCCGATCTAGGACTTTGAAACGCAGTAATTGTAGCCCTGGTNNNNNNNNNNTGTTAA
TCCAGTATCAAAACGCGACGGTGTCGACAGTATTGTCCATTCGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTTCTGTATTGGTTGCTTTCGTTGTGCAATCGCGATCAACATTTCATCTATATCNNNNNNNNNNGTAAAACTCGCTACGAGGGTGCCAAG
GATTTCCTCCTCCCCTATGTTACGCCGACTAATCTCCAACGTTNNNNNNNNNNGTCTGTATCGGTTGCTTCCGCTGTGCAATCACGATCAACATTTCATC
TATATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATAACAGGCCGATTCTAATGATCATGTCCTTTTAGCAAAGCTGCGGGTACCGCCCATT
T