Description :
From Genome Similarity Track
Location :
Scaffold_23:88483- 91274
Transcript NameFunction/comments
Phymu_g1519hypothetical protein PHYSODRAFT_350798

Sequence
2791 bases(100 bases per row)
AAGCAGCCACTGGCGAGTCAAAGCGCTGGCTGGAAAGTCTCGAGAAATGTATCCGCGCCATCGTGAGTATCCGCATCCTTAGCGTCCGGGCCTTCGACGG
CAACGGCGCTAGTTTCAGTGTGGCCACTGGCTTTGTGGTGGACATGGAGCGTGGCTTGATCCTGACCAACCGCCACGTGGTGACGCCCGGGCCCGTAGTT
GCCGACGCCATTTTTCTAAACAAAGAGGAGGTGGACCTCGTCCCTGTGTACCGCGATCCCGTGCACGACTTCGGCTTCTATCGCTTCGACCCTAAGAAGg
tcaagttcctgcagctccacgagaTTTCGCTGCGCCCGGAGGCCGCCAAGATCGGCGCCGAGATCCGCGTCGTGGGCAACGACGCAGGCGAGAAACTGTC
GATTTTGCCGGGGATTCTGGCAAAGATGGACCGGGATGCACCGTCTTACGGCTCCAGTTCGTacaacgacttcaacaccttctACTTTGCggcggccagc
agcacaagcggAGGTTCCAGTGGATCTCCAGTGCTGAATATCGACGGATGTGCTATTGCACTCAATGCCGGAGGAGCTAAAAAATCTGCAGCGTCCTTCT
ACTTACCTCTGGACCGCGTCGTGCGTGTCCTCCGCCTCATTCAACAGGGCAAACCTGTGCCCCGCGGCACGATCCAGACGATCTTCCGACACACGGCGTT
TGATGAAGTGCGGAGACTGGGGCTATTCGGAGAGACGGAAGCACTTGTGCGGCAGAAATTCCCACAGGAGACAGGAATGCTAGTAGTTGATCAGGTTATT
CAAGGAGGACCGGCACACGATCAACTACGGACAGGAGATGTACTCATCAAGTTTGCCGGACAACATGGAGCGACATTCTTGACGATTGAAGAGTACTTGG
ATTCGCACGTTGGAGAGACCGTTGAAGCGCAGTTTCAGCGTGGAAACGAGCAGTACACAGCTGCTCTGAACATCCAGGACTTGCATTCCATCACACCGGA
TAGATATTTGGAAATCGGCGGTGGTATCGTCCATGCGCTTTCTTACCAGCAAGCTCGCAACGCGTCGCTACCGGTAGGCGGTGTGTATCTAGCTCAAGCT
GGCCACATGTTCATGAAGGCGCATCTGGCCCAGCCGTGTATTATCACGTCCGTGGCTGGACAACCCACACCGACACTAGACGAGTTCGCGCGTGTTATGG
CGTCGCTTCCGAACGGCTTTCGCACGGTGTTGCGCTACTTTATGATCCGTGATCGTCACCGTGTGCGCACAGCCTTCATTATGATGGATCGCCTTTGGTT
TCCGATGCAAATGTGCACACgcaacgacgaagacgggCTCTGGTATTCGAAGTCGTATACTTCAGCTGCTTCTAATGGcgacactgctgctctgAATGGT
GCGAATGGCAACCCGACGTTTGCACCATTGCCATTGAGCTTCCCGGGAGGTAATGCGCTGGGCAAGAAAACGCTGTTATCGCTGGTGATGGTGTCTTTTG
ACATCCCGTACATGATTGATGGTATTTCAAGCTCGAGTTACCACGGGATGGGAGTCGTTGTGGATGCTGAACATGGCTTCGTGCTTGTGGACCAGAACAC
CGTCCCAATAGCTTTGGGCGATGTATTAATTACCATCGCTGCAACTGTTGAAGTCCCCGCTAAAGTGGTGTTCGTGCACCCAGTTCACAACTTCTCCATT
GTACAATACGACCCCAAGGCTTTGGGTGCCGTGGCCAGCCACATGGAGAGCATCACGCTGGCTGAAAAACCGCTAGAGGTTGGAGAGACTGCAGACTACA
TTGGGTTAAGCAGCAACTGGACTGTCGTCACCATGAAGTCTGTCGTTACCAAGCTTGACCGCCTTGTACTGCGCGATTTCCAGCCACCGCGCTATAAAGC
GAGCAACATCGAGGTGCTTCACTTCGACCGTATCACGAAATCTGTTGGTGGTGTCTTCATCAATGACGCAGGTGCTGTCAACGCACTTTGGCTTTCTTTC
AGTTACCAGGACAGTGCTGGTCGAAAGGAAGTCTTCCGTGGCTTACCGGTTAGCATCGTTCGATCCATCGTTGATGAACTTCGGACATCCCGTATCCCAG
ACTCTGTGAATATTCTACCGGCGCAATTGCTAACTTACTCACTGTCAAAAGCGCGCTCTGGTCTTGGACTGTCAGATGCTTGGATTCAGAAGCTTGAAGC
GTGTTACGAGGACAAGCGCCAAGTGCTCGGCATAAAGCGCTGTGCGGCTGGTACTGACTGTgccgagaagctggaaaGTGGTGACTTGCTCCTAGCAATT
GATGGTCAAGTCGTAGTGCGGGATGCTGACGTGGAAAAAGCCGTTGATGGTAAGACGGAGCTGAAGGCTTTAATTGTGCGCGACCAAAAGGAAATGGAGG
TGGCTGTAAGCACTTCTCAGCTCTCAGCCATGGGTACAGATCGTGTGATTGTCTGGTGTGGCCTAGTTATCCAGAGTCCGCATTATGCAGTTGCGAGTCT
GGGCTACATCCCCGAGGAAGGCGGTGGTGTGTATTGCTCGCGGTGGTGCTATGGCTCCCCAGCGCACAAGTACGGCTTAAGAGCGACTATTTGGCTAGTG
GAAGTCAACGGCGAAGCGACCCGGACGCTGAACGATTTCTTGCGGGTGGTAGAGCGCTTAGGCAACCGTGAGTCGGTGCGTCTGAAGACCATTTCCATCA
ACACAAAGCCCAAGGTGTTCACACTGAAGACTGACTACCACTACTGGCCTACAATCGAGTTGTGCCGAGAGGGAGGCAACTGGAAGTACGT