Description :
From Genome Similarity Track
Location :
contig_114:88461- 97159
Transcript NameFunction/comments
g11362.t1hypothetical protein
g11363.t1hypothetical protein PHYSODRAFT_477622
g11364.t1cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
8698 bases(100 bases per row)
CCGATAGCTGGAAGTTTGAGTATTTGACCCGACGACAATGCCCTCCGATCCTCGACGTGCTTCGAGAAAGACTGATCTTCCATCACAGATCAGCGAGACC
GGAATCTTCCGATGCAGGCTCAAGGTCTGCATCGCAAAGACATTTAAGCACCAGGCCGGCAAAAGGTCTACGAGTTTTCTGGAGACGCAGACGAACTGTG
ACTCCTGCAGGCTTGCGTTCGTTTGTTGTTGCGGAGCATCAATCATCAACTGGGATAAACTCAGCTACACGTCGGTCTAATGATCCCAACGATAATATCG
TCTTCCTGAACAACCCGACAGAATTTGATCTGCGCTCCTATTTGTTCAAGCGGCGAAGATCAAGCATCGCAACAGATAGACTCGAGAGATCGGTCATCAG
TCAACGCTCTATTGGCAGCAGTCGTCGCAGTCACACGCCCGGGATCACATCGACAGGTTCATTCAAAGGGGAAGCTCTCTTTGAGAAACGAGCAGAGGTG
ATGATCTCTTCTGCAGATGCATCGATCGCAAAACAAACGGGAAAACCGCGGCGTAGGCTACGAGCGAAGGAGGAATTATGCATCGTACTTCCTCGATCCA
CTGCCCGTGGCCGAACGCGGTCTCAGAAGTCCTGGTTTCTCGGACCAGGATTTATTGGGTGCGACCCAGGAGAAGGCACGCTCGTAGTGACAAAGGACAA
ATCCATGGACGCAGTGCATGCCGAAATCTCTGTAGCAGGGGACGACTACTTCGTACAGGACGCTCAGAGCACAATGGGTACCTTTCTTTGCCTGAGTACA
CGCTACCGACATTATCCACAGAGGGATGGTTTCCGCTTGTGCCATGGAGACGTCTTCCGGATCGGACCGGCTACTTCAATTCGCGTTCTTGATCTGCAAA
CAACCACTGAGACAGCTCCTATCCAAACCACGCGGAGCCGCTCTAGTTCTATCGCCAGCATTACAACCACAGCAGCAGAACAGTCTGCATTAAACTCTGA
GAGCAGTACATCTCATACCCCCAAGCTTGAAAAAACTGCAAGTGCCAGCAGCAACAGCGGTGGAAACGCACAACCAGGTTTGAAACGAATGTCGACCGTA
GAGGAACTTCGACTTCTCGCTGCTGATATTGAAGACGAGCTCATGAACGATGTCGGTAGAATCCATCCAGGAGTTACACCGCAAAATGAAGCCGGCAACA
TCACCAAAGATGACCACAGAGGGGAAATGCCTGCTCAATTAAAACCGCAGCACATCGTTCACTTTGCAGATACGCCCCCAATGATGTCGGATGGATCCGT
TTTCTTGGGTAGTCGCTACATACGTCCAGAAGTGAAGGAACTGCACTACTGTGAACCATCCCAGGTAGAAGATGCTGAGGATGATACAATCAAGCAACTC
GTTGGAAGTGAGCACGAATCACCACCAACAGAGTACGCTGGCTCAAACATACGCCGGGCTGCATCGATTCGCCTCGTCATTTTCCAACATGAATCTGCTA
ATGCCAGTACAGAGCCTTTAAAGCCGCGTGAGGCTCGCGAAGTGACACTGACTGGCCAAGGAACGTATCTCATCGGCTCCTCAGCTGCTTGCGATGTGCG
CATTTTTCCGTCGGAAGGTATTGAAATCCGTGCTGTGCACGCTCGGATTTTATTTGACGGCACATCGTTCGTGTTGCAGGACGTATCATTTGAGCGCGAT
CCACGTCGACAAACACGCGTTTTACTCACCCAAAGACCCGTGAGAGTTACACGAGGCGATTGGCTACTACTTGGTAAATGTGCGCTGTACATCACGACCG
TGGCCAGAGCCTTTGGCTCGGTGCGCCGTCCAGATATGAAAGAAGCAGCCATGCGCTTGGACGTTTTGAGACTTTCAAAGCGAAAGCCAAGGACACGTGG
TTTATTCGTGCCCGTGGGGTTTCGATTGCACTCGTCATCAGGCTCCGGAGCGTCTAGCGGGAGTAGTGGATGGGGTGGCAGCAGTGGCGGGCCTGTCACG
TTTGGCAAAGGGCGAGACTGTGACGCACAGGTTTTCACGGCGTCTCTAGCGACCGAGCAATTCAGCGTCCAGCTTGAGCGGGGAACATGTTTGCTCACGC
CTAAACCAACAGGAATCAACGCTGGCACATACTTCTTGATCGGACGTGATGAACCTGGACAGCCATTCCTCGAAGATGGAGGCTACAACTCGAGCGACAC
GGAAGAATCCAAATTCGAGGTGGTCAAACATACGAGCAAGCCTCTGCTGCTATCGGAAGGGTGTGTCTTCAGGTGTGGCGGGTGCGAAGTGGAGGTAATC
TATTCAAAAAGCGCGACTGCATCTGATTTGAAGAGCACTGCTGCTTTTGAAGAGCAAGAGCACATCCGGTTCTTGAGTGGCATGCCATGGTTGAAACCAA
TTGTCTCCGACTTGAAAACCATTACGAACGTTGCACGCTGCGGCCAGAGATTGAAATTGGGCCCGGGGAGTTGGTATATGAGAAAGGTGACGCAGCAAAT
TTCGTGTTTATCGTGATCAGCGGCGAGGTGGCGCTCCATATTACCTGTGCGAACGATGAACAGGAAGGGATGACTCGGAGATATTGACTGAACAAGTGAC
TGCCGGCGGATACTTTGGAGATGTGAGTTTGTACGACCGATGGAACTGTACGCTTCCGCACCAAACTGTGATGGTCATGAGTATCCTGAAACTGCGCGAG
CTGCTAGCGCTTGTGAGCTGCTAGCATTGGCTAGAGAAGATGTTTGCGGGTATCTGGGTTTGTATATGGATATTGTACGCGCTCATCTGCGCCACGATCA
GTGTCGCGACAAGACCATCAGACTGGCATGCATTTGTGTGCCATGGCTGCGGGGGATCTCCCTCCACGAGATGCGCTTTCTTTCATCACAAGCTGAAATT
GCTGTGTATCCTCCAGGATCGATCCTGTTTGAGGATGGAAAACTTTTTGTCCCCGCTGCTTTTGCTGGCGGAAACACATTTCAACTGCGGGATGGGTTTC
TCGTGCTCATTCGGGGATGCCCGGATTGTCAGAAGAAACAGAGCGACAATATCGGCGAAGCAGAAAAATACACCAGGCAGAGGATGTTGAAGAAAGAGAT
TTCGGCGACGTCGACGAGGAACCAGAACAGGATCATGACGAGTGGTGGAGCCCAATGGATCCAGTACTTGCATTGAGCTGGAGCTCGTCTCCGTCTGTGT
TGAGCGTTTCTGATCTGTCATTTCGTCTGGAAGCTTGCTCCACCGTTGAGTGTTATTTTGTTGCTGCGGTGCATCTCGCCCATCTGGATGTCGATATCGG
AACCAAACAACAGCACACTACCTCTTTTGGGCCAGAGGCGTCTTCTGTCGCCCAGGCTCCACCACCATTGAAACGAGTCCATTCGTTAGGTCCTAGGCGA
ATGCACCATTCGCAGGTCGTGACCAGCGCTTTGCACAGTGGTGGAAACAGTCATGGAGACGACGATGACCATAACTCGTTGGACGGGTCCGATGGAGAAG
GTGATAACACCGCAGCTCGCCGATGGAGACGCAAAAAGCGTAACAAGCATCTTCTCGAGCAGACAGTGCTGGAGACGCAAAACGACGCGAAGATACCAAA
CGCGTTGGTATTATACGTGCTGGCGGGGGCTCAGAGAGGGATATCCACGTGGTTCGCAACGTGGCATCAATAGGCGGCTTTCTTAGCGGAGCAGACATCG
AACTCAACGACCGGTATATATCCCGTGCACATGCCGTTATTGAATACCATGAAGGCAGATACTGGTTGTACGACAACTGTAGTAAGTGGGGAACCTTCGT
ACGCCTTGAAGAGGAGAACGCCGTCGACATCAATCCAGGAGACGTCTTTTTGGCCGGCGAAGTTGAGTTCACGTGCCTCACGTCGTACCCGGAGCGAAAT
AAACCCAGCATGTGCTGTGTAATGTAAGCCATGGCGAACCAGGCCGTGAAAAAGAGTAAATCGTAATGACACTGGATAGAGTACCAGCTTGACCAGTGGC
TTTATTCAACAGTCTTACATGACGCCAGAGATGAAGCAACCAGCACGTGCGCTAGTTCACTCGTTTGAATAAATTCCTGTCCTGATCGGATATCAACACA
GACTGGACCGCTCAAGGCCTGAAGACCACCCACAACAGGCAAAAACTCGATCCAAACAGTCTTCGCTGTCTTGGCTTCTACCATACCAATATTCTGTGGC
ATCATGCAGAGCCACACCAAAGAGATCAAAAATGTCAATCACTAGCTACCCTTTTAAAACAGCAGATAGTACTCAAACTTACCTGGTGAGACGCTGACGA
ACACACAATACCGTGCATAAGTTCCTTGCGGAACTGTAGTTGTAGTGCGAGGCTTCGAGTAGAGTTGTTGATCACCGATATAGGCACCAGGAATGGTTGT
CCAACCGCGACTTCCTTGGGTAGTTCCTCAACAATCACTATGACTTCGCTATGCTGCCCTGCTCCAACGCCAGCATGGCCGGAAGCTCCAAGAGCTTTCC
GCATAACTGGCTGACTCTGCACTGATCCTGCTTCTCCCATTGATATTTTCCACCCAACATGTAGTCGGCCAAGGTTTTGCGAGCCCTGGACAAATATACA
CAAAATAACATCTTTTAGATCGAAGAACTTCCCAATTTCGCGCTATGAGGCATTACCTGCGCTGATAACAACGTCGGGTCTGACATGGGGTCGTACGATA
CACGGAACACACGTTGCAGCTCCTCCTGCGGGTATACAAGAGTCTGCGGGCCATTTGTTGCGAGAAGGTCCTGAACTGATAGTTGTTCTCCATCTGCCTT
CTTACCAGCAACGTGCATCTCTTCCGATGTAAACGGCGGCAAGGGCAGGAATTTGATGCTGTCCACAAAAAGTGGCAGTTTGGACACATTACGGATCTGA
GCCTCAACGATAGCCTCGCCCTGCTGCTGCTGCTGGTTGTTAGCTGCCGAATTCTGCTTGAACGTGATCACCAATGGGTTCTGCACTGCAAACCGGTAGA
ATTTGCGGAGCGACTTGCTTTCGCCGGTCACGGGGTCCACGTAGGTCACGCCCACCCGTAGCACGTGGTTCCCCACCTGATTAAGCGGATAATCCACTAC
CATATCTAGACTGGAACCTGCAGGCAGCACAGCCACAGGATTCGGTGGCGGCAGTTTCCCCGTCCTCGCGTAGCGGTTGTCATGAAGCTCTACCCGGTCG
TTGGCACATTGGATGTTGGCCGACAGCCCGACGTCCCGCAGCTCGCACGAGTACGGGTTGATGACGCTGATGTAGCTGCTGAAGGTGTTGCCCAGAAAAA
TCTCTCTGTCATAGTAAAATGCATATAAAACATATTACAAGTAAGACACATCATCCCAAATATGACAATGAAGAAGCTTTGTCGAACCCGAAGCTGTCGG
GCAGGATGAGCATGCTGGACAGCGCGAACTCGTGCTGTGTGGCGGTGACCTCGTCCAGGGGCGGGCAGCATGGAACCCCCGGTAACGCCCTGCGCGTACA
GCTTGGGCTTGTACAGTCGCATCACTAACAGACAACAAACAAGAAAATCGTATCAAGAGGAATATTTCAGATTAGAGTACAAGAGCCGCAGAAGAAATAG
ACTGCCACCTTTGAGCGTGGGCTGCACGGACGGAGAGGACGCTGGCGGGGTGCTCCCGCCGCCGGAAGAGGGCGGGCCGCTGGTCCCGTAAGCGGAGCTC
ATGATGAAGGAATAATGGATCGCAAAGTTGCGCTCTCAGAATTATGTTGCTCTATCATTTGCGCACCGTAACGTTGCTATGTTGCGCTGGTATTGACCCC
TCATTTGCTTTCAGAATAGAGGAAGATGCTTGCTCGCTCGCTGTTCCGCGCCGCCTCGAGCGTCCGTGCGTCGCCGTCGCTGGTCGCTTCCTTCGCCAAC
GTTGGCGCAATGCAAGTTGCGCGCTTCTCCGACGCCCCCACGGTGCGATTTGTCTCGAAATGTGCGTCGAATTACGTGAAAACTCTCGTCTCAAAGGTTG
TTCATGATGACTGCGTAACGTTCAGATGCACGGCACGACGATCTTGTGCGTCCGCAAGGGAGGCAAAGTGGTGCGTTGGATAGAGCGGAGAAAAGTGCAT
CGCGTATGTTAACTTGGCGAAGAAGGAGGGCTAATTGTTGCTGTAGTGCCTGATCGGAGACGGCCAGGTGTCGCTGGGCAGCACGGTGGTCAAGCCCAAC
GCCAAGAAGGTGCGTCGCATCGGCGAGCACATTGTGGCAGGCTTTGCTGGCTCCACGGCGGATGCGTTCACGCTCATGGAGCGTCTGGAGGCCAAGCTGG
ACGAATACCCGGGACAGCTCACGCGGTCGTGCGTGGAACTGGCCAAGGCTTGGCGGACGGACAAGTACCTGCGTCGTCTGGAGGCCATACTCATCGTCTC
GGACACCAATCAGTCGTACACGCTGACGGGCAACGGAGACGTGCTGGAGCCGCACGACGGCATCATAGGCATTGGCTCGGGAGGCACCTACGCTCTCGGT
ACGTGCAGCCTGGTGTTTAGTGAGCTTTTTATTGTTATTTTTGTGGAGATGATTGACAGCGCTGTGTTGGACGTTGTAGCCGCTGCCCGTGCGCTTATCG
ACCAGGACCTGGACGCCGAGACCATCGCTCGCAAGTCCATGAAGATTGCCGCCGACATTTGCGTCTACACGAACGAGAATGTTACTGTGGAGATGCTGGG
GAGGGGGAGTCTGAGGCCAAGACTGACAACAAAGAGTAAGATGAGGTAGAACAGGTTGCACTGAGGCGTGTAATTCGTCAGCAACGCTCGAGTAAATACA
AGGTCTGAGCTGTTGAGTTGAATCGCCTAACCATTGCAAGCAGAACGTAACCAAGGCACAATGGCGTGTCTGAAAATATGAATATGATAGTCGTGGTCGG
GCAAAGGAAGACAAAGAGAACGCTAACAAACGTCACCGAAATGACTGCCATCGCCGTCTGCCCCGTGAATGCAACGCCAGCATCTCGGTTGTCAGTCACA
GTCCACAGTAGTGTGGCACGCGAGGTGCCAGATGTCCTTCGTCCCTCGTCCCTCGGAAATTGTGATGGTTGAAGGCGTGTATAAGATGTAGTATTGGTGC
GCGTGTGCGTTTTCCTTTTCCTGATGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGAATGTCTTCTAGCGGGCCC
ATAACTCTCTTGAACGTTTTACGGTCCAACGTGAGACACTTAACCTTGCCCTGGGCGGTCACTGTTGCCTGACGAGGCCGAGTTGTGAGCAGTGCGATTT
CACCAAAGTACGCGCCGGATGTGAGCTGGCCCATTTCCACTGGCGGGTCTGCGGGCGAGAGCTGCTTCGTGCACACTGCCGAGCCTTCCTCAATAATGTA
AAACAGGTTGCCGTCGTCACCCTGTGCGATGATGACTTCGCCATCACTAAACGTTTCTGTCTTCAGAGCGTCTGCGACTGTGAGACGCTCGTACTCGCTG
AGCGACTCGAGCAGTGGTACACGCTCAATGAAGCCCTTGTGGGCCTCGCGTTTCTTCAATGTCGTTTCCATGATGATAAACTTGAAAGTCTGGCGATCTA
ATGCCCACGCCTTCGAGTGCTGCACTGCTTTAACGGTTGCTGCTCGCGGAGCATTGTACATGAGGGCCAACTCGCCGAACGACATTGCTTCAGTGCACTG
CATCAGAAGACAAAAAACATGAGCACCCTGCCACTGAAAAAAAGCAAGAAACCCCTTCAGTAGTGAACCCACCGTCTGTACGAGATCGCCGTCCTTGTAA
ACTTCACATACGCCGCTCTCCAGAATGTAAAAGTTATCTCCGTCGTCACCCTGCTTGATGATGGTGTCACCAGGCTCGAATTCCTTGGGGAACATGGCGT
CGAGCACAATTTCGTGCTGCTTCTCGTCCAGCGACTTGAACAAAATGTTCTCCACGACCATGCGACTGATGCCCTCCCGCTCCTCTGTAGACTTGGGGTG
CACCACGCGCTCAAACTGCCGCGCACTGCCACGTCACACCAAGTCAGTTTACCATCAGACAGGACAGCGCCACCTCATAACAAACTGCTCACCTCAGCGG
GTCAATGGTTTCAGCGGACACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGCGGCGGCGCGCTGGCTGCGATCTCGCCCACGGCGTCTCCACCCTCA
TCCTCGTCCTCGCTCTCGGACTCGTCCGAATGATCTGCCAAGAAAATGCACATTAGATCTCCATTCTCTACCATTAGGTAGTGTAACTGCCCACGACGCA
CACTGCACGTGGGGCGAGGCGGCTGGGTTGTCCTCCTTGGCCCCAGGCTTGCGGCGAGGTGTGGCCTCCTCCGGGTAGTTGGTCTGCAGGTACTGGATGA
TGTGCAGGATGGGGTTCTCGGGCTTGGCCAGCAGCAGCGACTCGACGAGGTTGATGAAGAGCGTGTTGATGCCCTTCTTGTGCAGGTAGTCCTGCAGCTC
CTGTTGGACGCCCTCTGCGTCCGTCATGCTCCTGTGCGGCGAGTGTCGTCTTGCGAGTGGCTAGCTGGATCCTTCCGTCTCGGGCTTCTGCGTGGGCCTG
AAAACTAAACTGAGCCTGGCGTCACGGGGCCTTCGCTCCAAAATGGAAGAAACCCCTGCAACAGACGCTGAACCCAAGCGAAAGATCGCCCCTTGTCG