Description :
From Genome Similarity Track
Location :
contig_60:88456- 89606
Transcript NameFunction/comments
g10677.t1hypothetical protein

Sequence
1150 bases(100 bases per row)
GACGTGCCGCCGCACGTGTTCGCCACGGCTGAGGAGACATACCGCACGATGCTCAGCGAGGAGGACAACCAGTGCGTCATCATCAGCGGCGAGAGCGGCG
CCGGTAAGACTGAAGCCTCCAAGCAGATCCAGAACTACATCGCGGGCGTCAGCGGCAGCGGCGCAGGCGTCGACAAGGTGAAGCGCACCTTCCTGGAGAG
CAACCCGCTGCTCGAGGCCTTTGGCAACGCCAAGACGCTGCGCAACAACAACTCGAGCCGCTTCGGGAAGTACTTCGAGCTGCTCTTCGACTCGGCTGGA
CGACCGCAGGGTGGCAAAGTCACCAACTACCTGCTGGAGAAGTCGCGCGTTGTCAAGCCGGGCAAAGGAGAGCGGAACTTTCACATCTTCTACCAGGTGC
TAGCCGGACTGCCCTCTGCTGCCAAACAGAAGCTGCACTTGGCTCGGGGGGGTCCAGAGAGCTACCAGTACTTGAAGGCTAGTGGATGCTACGATGTCGA
CGACGTGAACGACGCGCAGGAATTTGACGAGACCATGGCAGCCATGCAGCACGTAGGGATCAAGAGAAAACAGATTGAACTCGTGATACAGACGCTGGCG
GCCGTGCTGCATATTGGCAACGTACACTTCCAGCCAGAGACCGTGGGGGATGCGGAAGGATCGTCCGTGCGCGACCGCGAGAGTCTGCAGATTGCGTGTG
ACCTACTGGGACTGGACGCTGCCCGTCTGGAACACGCTCTGTGTTACAAGCTGTTGCAGACGATGGCGCCTGGAGGCAAAGTCGAGTCATACGAGGTGCC
GCAGAACACGAGTCAGGCGAAGTCTCAGCGCGACTCCATCGCCAAGGCTGTTTATGACCGACTGTTTGATTTCTTGGTGGAGCGTGTGAACCACGCGCTG
GACATTGAAAAGAAGGCGGAGAAGCATGGCGAGATCCTGGAGATCGACGATATGACCACGATTGGTATCCTGGATATCTATGGTTTTGAAATCTTTGACA
AGAACGGGTTCGAGCAGTTCTGCATCAATTACGTCAACGAAAAGCTGCAGCAGATTTTCATCGAGCTCACGCTGAAGAGTGAGCAGGAGGAATACGCTCG
CGAAGGTATCGCTTGGGCCCCGATCCCGTTCTTCAACAACAAGGTCGTGT