Description :
From Genome Similarity Track
Location :
Scaffold_583:8841- 12300
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_583-snap-gene-0.13Vesicle-associated membrane protein-associated protein A
Pytul_var.sporangiiferummaker-pug3_contig_583-snap-gene-0.14Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_583-snap-gene-0.12Nucleolin

Sequence
3459 bases(100 bases per row)
GGATCGTCCTGGACAAAGCGACAGCGCAGCTTCTTGTTCGACAAGCTGCGCTTATCCGTGTGCGCCCACATATTTGTGAGATCGTCCGCCATCTCTTTCG
TCGACTTGGTCTTCACTAATTCGTAGAAGCTGTCATCTGCGTAAATACTCTGCACCAGGAACTTGTCGTTCGAGAGCTGGCGCTCCGACGGCTCCAGACG
CAGCAGCTCGTCGCAGTCGCGCTGCTGCAAGATCACCATGATCGATGCCGAGCCGTTCGGGCCTAGCATGCCCTGGTTCGGACGCACCAAGTACCGCAGC
GGACGCGTTGTCTTCACCTTGAACGCGATCTTGCGCTCGTCCGACACGTTGCGGATCGTGAGCACGGCCTGCGGCGCCGCTTGCGGCTGCAAGTGGAACG
TCAGCGATTCGGCTGGCTCCAAAATCACGCTCGAGTTCGGCGCGATCGCCACATCCAGACCACTTGTATCGGCCATCGTTAACGACTGCTGCTTTGCCTT
CTCCTTGCTTCTTTACAGTCACTTCCTATGACAAAGACAGAATGCGGAATTCCCACATAACGACACTTGGTTAGCGCCAGAGTTTGCCCAAGAGAGTTAG
AAAAAGCGAAGGGGGAGCGCCATTTAGCTGCCTTCACATATGTGCCGTGCGCATGCACTACACACACGTCAATGAGCGCATGGGGGCGGTGCATTGAGGG
GGCCGTACGCACCTGCAGCACACGCGCTTCTTTTCTTCCTGTTAGCGCCGATGATCGCCGGTTGTTGTGCTTGTCTTCTTTCGTTTCTTTTGGTGACTTT
CGTTATTGCAGGAAAGTATATGAATATTTGCTGTAGTTATTTTGATTAATGTGGTTCATGTGTAGTCTTGGATGGGGTATATTTGTAATTTTTAGGGACG
TTAAGTGGCCTTCTGATGGGAGGAAGAGGGAGAAAAAGCAGCGTTACGGCCACCTATATGTTCGAAGTGACAGCAAGAGAGGCGGAGACCACCTTTTCAC
GCACAGGAGCGGAGGCCAAAGTTGGAGCAAATATGCGGATCCTGGAGACAGTAGCATTGGCATGGAGAGCCTTTGCGTTGTATAGATGCAGGAGCTGTCT
CTTGTAGAGGTGATTACGTGTATGATGCTCTCCAGTTCCGCATTTGGCCTTCAGAAAATCCATCATACCGATAATGAAGAAGTTGTTGAAGAATGCTTTT
GTTATAAGCGACCCAACATCAAAATTAATCTGTTACAAGCGACATGTACCCCTCCACCGTAACCATATGCAATTCGAGTAGCAATGAAGAGTGAGCATGC
TGAAGGAAACGGGATGCGTTGTGATTATCCATGTACACGTAGAAATATAGAGCGTATAACACAAAGCGACCGATCTTTTCTCTCCCCCACACTTGCCGCA
CCCATCCAACGTCTTGCTTCTTGTATGCATACATTTGCGCAAGCCCAAGGGTCCACCAATGCTCACACCGTGTTGTGTTCCGTGATCGTCTGTGCGTACA
CCTTCTGCAACTCCGCAAACTGGGCTTCGTATTCCTCGTCGGTCAAGCGTGCCATCGCTTCCGCGAGCGGCGTCAGCAGGTTGAGTGTGCGCTCAAACTT
CTGCGTCTGCGACGGGCTCTCAAATTTGGGCGCTAGTTGACGCGGCAGCGTCGGAGCGAGTTGGTTGCGGCGCATGGTCTTGAGCAGCACGTCTGGGTAC
GCCTCGTAGATTTCACGGCTAATAGGGTGATTGTGCGACACAACCTGTACATTTAAAAAATAAGATCAGTATCACATCGAGCTTCAAGATGCGTTTCAGG
TTCAACATTGCGTACCTGGTCGGTCACGATCACCATGTAATGGTTCGGGTTGTCCGACGGACTGATCTTTACGTTAATCTTCGCAATGCAGCCGATGCCG
CGGTATTTCTGTCCAGGCCGCGTTGTAGCGCNNNNNNNNNNGCGTACACATGTATATCCGGTGATGGTGGATCGCCGAGTCGGGGAACTCGATGCGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCACGCGAGTTCTTGTTCGTCATCATCACTTTTTGCTGGTTGCGACGATATGCTTCGACACTGCA
CGACGAGCGCATGCGGAACGGCTGGAACGTGTCTTGCATGTACATCTCAAAGTACGAGTCAAACTCAAACCACGAGTTGAACGACACGCGATTCATGCGC
TTGCTCTCGAAGAGCTGCATGCGCTTTTCTGGCTGGCTGTTGAATTGCGTCGTGCTCGCATCAGTCGCTTCCTTCATCTTGGCCATCACGTCCTGCATCG
CGTCGTTTTCGTCTTCCGTGAACTCAGTGTTGTCTGGTTCTTCGTCTTCAGTATTCGTTGATGACGCATTGGCCGCAGCGCCAATGACGGCAACAGTGGG
GNNNNNNNNNNTTCACTGCAACGCCATCGCTTCCAGGAGGGATATCCAGCACCGAGATGGAATCAGTCGAAGCCGAAAGGACGTTGTCGCCATCTGCAAC
GCCAGGAGCTACGCCCAAGGACGCGGCGCTGGGCGTCGAGCCTGAAGAGGACGAGGACGACCGCGCGCGGCGCTTCTTGCTGTCGGAGCCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGGGCACTGCTTCAACCAGATCGTCGCCGCTCATCGTCGCTATTTCTCCACGTTA
TCTATCGCTCGGCACTTGTGGGGATTTCGAAAACTACGTGGTCCGAGATGTCTGGTACACAATTGAAACATAAAACCTCACGGCTTTCCTCTGCTTTTCC
CGCGCCAGAAGAAAAAGAACAACAATGAAAAAACCTTACGAGTCTCACATTTCATTGTGGAGCAGTGTATGGGCCAAATAGATGGAGCATCCCACTTTGC
AGCCTACATTTTTATGGAGCCTAAAAGTGTGAGGAAGAGGCCGTTTGATGTATGTCGCGCGAAGGTCGCACGAAACGTCAATGGGCAATAGCCAACCAAA
TGCAGAGTGTCGTTTCGATCGATCCCTCCAATCATTTCCGCGGCGCACCGGCCTTCAATACCTTCCGCAGCATCAGTTCCATATATCCGCTCGACGGCGC
ACGCCACACAGACCCCCTCCGCCTTTCCTTCCCTCTCGAGCAGCTACGATGGCCAAGAAGATCACCAAAACCCCTGTGAAGCCAGCGTCGAGCTCCGACA
GCTCGTCGGACTCGAGCTCGGACGAGAGCGTCAAGAAGGTCGTTGTGGCCAAGAAGCCTGCCGCCAAGAAGGCCGAGTCGTCCTCGGACAGCAGCTCGGA
CTCGTCGGACGACGAGACCCCTGTCGCCAAGAAGGCCGCGCCAGTCGCTGCCAAGAAGGCCGAGTCGTCCTCGGACAGCAGCTCGGACTCTTCGGATGAC
GAGACCCCAGCCGTGAAGAAGGCGGCGCCAGTTGCTGCCAAGAAGGCCGCGTCATCGGA