Description :
From Genome Similarity Track
Location :
Scaffold_21:88409- 90606
Transcript NameFunction/comments
Phyke_g1373hypothetical protein PHYSODRAFT_426731
Phyke_g1374hypothetical protein

Sequence
2197 bases(100 bases per row)
CCTCACAAAGGCTATTTATCGACAAGCACACGCTCATGACTTCCACTACCCCGGAAGGTCGAGCCGCGAGCGCTCTCGCCTTGCATGAGCTGGACCTTCA
CCTTTCGGTTCGTGATGTCGAGAGCATTGTCAAACTGGAACGACATTTGCTACAAGGAGAGCGACTCCACCTTCTACACGAGTACTGCGCTCACGGTGAT
TTACTCGAGGTcatgcagcaagagcttcgaCTCCAATCTGCAGGCTTGTCGCCTCAAAAAGCTGCCGTGACGACTTGCACAGATGCCGGTAGACGTCGGA
TTTTCTCTGCTGTGCTGCGGGGCGTGCAGGCATTGCATGCCATTGGGATCGCTCATTTGGACCTGTCGCCCGAAAACGTATTCGTGGCCGATTCTGGGGT
CGTGAAAGTTGGAGATTTAGGGCACGCTCAACGATTCAAGCATGGTCAACCAATCGTTCGTGTCGAACAAGTCGCTAAAGAAGCTTACGCAGCGCCGGAG
TTGCTACTCACTAGAGAAGTTGACGATATCCGAAAAGCCGACGCTTGGTCGCTAGGGGTCATCCTCTGGACGCTGTGCACCAAGCGAGCGTTCGTACGTC
GCGCCTCAAATGATGACGCACTCTTTGAGCGGATGGTTGAATTTGGCACGGCTACTGCTCTCCAGGAGACTGGACTGCTGTCGCAAATGCCATCGTCGCT
GGCTGATCTGATTGTTGGTCTATTGGAAATCGACCCGGGGGCAAGACTCTCAGTGGACGCTGCACTGCAGCACCCATGGACGAAGCTCTCTGCTTCCGAC
ACGGAGACGGCCAAGCAACCACAGCTATCTCGACGAAAATCTATCAGCAGcatgatcaagaagaagggcgaagacttgatgaagaagcgCCCCAGTGTTA
AAAAGGGGCGAGGCCGTACGGCTAGCGCAGAAATTGCGCTGGAGGCAACGCGAGTTACACTAACATCACGAAGTCGAGCGTAGAAGGAGTCAACACGTAT
GAGCCGCAGTAGCGTCACCACAACTATAAACACCCGAAAAATATGAAACCACCTCGCCTTTGCTCAAATGAATTTGTCCCTTCCAAGCCGTCGCGACGTT
TGCTCGAGGCCATTGTGATTCCTCATCTTTAaatcgtcgacgtcgtctaGCAGGGCCGGTTGTGCGTGCCGACCGGTACCAATGCGCCGACACTATCTCT
TCGCCGAGGATGAAAAGGAGCGCAGTGTTGGCAACGGCAAGGCCAACCTGCTAAAATTGTGGCATACTCGACGATTGGCTATGATTGAGGGCGACGAGTC
TGCGAACGGAGGCGAGGCAAACGCGTTGGTGGTTCGGGAACTGACGCTGATGTGGGACCTCGCCAAGCCTATGACGTCAATTCTGCTGTCGCGCGAAGGG
TACATTGGTTTCTTCGCTCGTGCTGCAAAAGCTCTTGTGCTACCAATGACATCCGATACGgctgctattgctgttgcacaGCGCGACTGGGAGTACGATC
TAGAAGGTGTCAGTAGCATCAATGAGCCCACCACCAAAGGAATGTCAGTCCTGGACAACGAGATGATGGCACCTGAGCAATTCCGTGAAGCTCTGATGCA
ACTCGCTGAATTGGTTCTTCCGGTAGAAAGCACCGCTAAAATATTCGCATCTTTCTTTCGTGAGCTGCGTAATAGCGTCGCGGAGGTTGACGCCATTTCC
AGCAATGAGCCGGAGACCAACGTCGGAGATCCGGCCGATCGCCTTGTGCTCCGACCATTGAGTCGTATTCCTAAGATCAGCAAAGACGCGTTCCTGCAGA
AGTTGCCACCATCTAGCGATGCATTGCGAGCAATTCACGGATTGCAACCGCCCGATTCCCGCGAGATGTcactgaagcagctcttACTCAGCTATAATCC
ACGAAAATTCTCTCTCACACGAGCATTTCCGCACAAAGATCAGTCTAACGATAGTATCGATGAGAGTGTGAGCAACATCGAGGAGATTAAAACCGAAGCT
ACAGATGACCCCGAGCCCATTGTCGAAGATGATATGGTGATGGCACAGCGACTGCATACTGAGCTGCTTGGTGCGATTGGTGTAGGGGCGACCCCAATTC
GAGGACGTAGACTTCATCGCGAAACCACTGCACAATGGGATGTGGAACAAGCACTCGTAGATACTCTGACGGAATGTCCGGCGTTGAGAGTAGCAGT