Description :
From Genome Similarity Track
Location :
Scaffold_32:88402- 91252
Transcript NameFunction/comments
Phyke_g1854hypothetical protein

Sequence
2850 bases(100 bases per row)
GATGGCTGGTGGTTTGTCATTAAAGACGGCGAGAAAGGGCTTGTGCCAGGATCCTATTTGCATATTGAGAACCCTGTGATCCCGATCACCGATGCGACGA
TCTTGGCAGCTCGGGAGGCATCCAATCAGCGCTTTATGGAGTTATCGCGATCTTCTGGAGGCAGCAGTGTGCAAGGCTCGGAGGCAGGAGTGGAGTACCA
GTCACCGTACGGATTGGAAGGTCTTGCGATTGCGGACTCGTGCGCTCCGAGACCACCGTCGAGTGGACCTGGTAGGGCGGATGCAAAGTCTGGAGGCACT
GAGTTCAAACCTGGCGAGGTGCGCAAGCTGAGGAAGTGCTACGCCTGCAAAGAGACTATTCTGGGTCGCACGAAAGTGTGCAAAGATCAGATTTTCCACG
AAATTGTAAGCTCATATTTGACTTCctggttgaagtggaacGGAGTGACAGCGTGTATTTATTGATGTGTGTTTCGTGTTGCAATCTGtagtgtttgctg
tgcaaAGGCTGTCGCGAGTcaattgaagaagacgaggactTCACCCTCATCAAGAAAAAAGTGCGTTAGGGGCATGTCCTAAGTACATGTTAGTGGCATT
TTGTGTGCGCTAATAATTTCGGATGTGATGGCTTTTGCAGGCTTACCATGCTGAATGCGCCAAAGACGTCAACCACTGTTTCGCTTGTGACAAGGTACCG
CTCGGATTCTATGTCCAGGTTAATTTCCTAGACTAAGGGTATTCTGTGTCTTTTTCTAGGAAATTCTTGGTCGGGTGTATCgtgctggcgatggcgcCTT
CCACAAACTGTGCATGATTTGTTCAGTTTGCGAAAAACAGGCAAAAGAAGGTAAAGATAATCCTTAACCTGGCTAGCCTTCGGAGTGTGAAGGAATTTGC
CTAACGGTTGATCAATCTGTTTGATATGGCAGCTGGTGCGAAATTTGAAAATGATCTGCTGGTCTGCGGAGactgtgctgcagcaaaaggtGAATCTCAG
AATGCTGTGCGCCGTAGATACGTATACAGACCTTCTAATGAGCTTCATTGGGATACTTGCAGAAaaaaaagagagagaagaaagagaagcagctcttgaa
CGTGAACGGGCTGCTGCTAAGGCGAAGGCAGAGAAAGAAGCGGCTCTTGCTGCGGCACGGGCATTGGAAGAAAAGAAGGAGCGGGAGGCACAAAAGGCTG
CTGAAGTGGCTGCTCATGCTAAAGCTAAGGCAGAAGCCGAAGAGGCCGCTGTTGCTCGTGCACAGGCGGAGGCGGAGGCAGCTGAGGCAGAAGCACTgca
aaaagctgcagctgctgctgtcgcaTCAAAGGGCAACGGTTGGAGTGGAACTGACAGCATCCGATCTAGCACGTCAAATCTGGATGAATTCGATTTGGAG
GCCACTCCCATGGATATGTCGAACTCGAATGGACGGATCTCGGAAGTGTCGGACCTGGATTCGATCCTCAGCGATGGCGAGTACGCAGGATATATGGGAA
ATGGCCAGAGAGAGTCACTACGTTTATCGGAGGTACTCGATCTCGAGTCTTACAGCGACGACCGTTTATCTGACCTAAGCGGAATTTCAGAGGGAGCAGG
TGGCCATAACAGACCCCGGCGCTCAACAATTGAAGGATCAGTGaatgaaaacgaagaaacattttcagaagatgaagatcgcGAGCTGTGTGGGGGGTGC
GGACTTGTGCTTGAAGGAGAGGCTGTGGGAGCCCTGAACCAGTACTTCCACTACGAGGTACACACTGTGTGATATACGCTGTGGACGCCGATTCGTGCTA
ACGTTTGCACATTGCTTTTGTTTCTGCTCTAAAGTGTTTTAagtgcagccactgcacccGTGTTATCGCCGAAGACGACGGCTACGCAGAAAAAGACAAC
CAGGTACTTTATCATGATCATGCTAATTTTGCACGTAATGTCTGCGTCGGATTTCTAACTGGTTGGGCTGGTTCCAGGCGTTCCATCAAGCATGTTACCA
GGCACGGTTCGGCAAGAAATGCCACCGGTGCGACAAGGTATGATGTTATGCTGTTGGTTTGAGATTCGCCATACGCCTACTCAGACGAGTCGTGATTGCG
TGTCGGTTATAATGCAGGTCCTCAAGGGAAAAGTGGTCAAGGCTTTAGACCACCTTTACCACCCAGACTGCTTCATATGCTTTAACTGTagctcttcgct
ttcagGTACGCACCTTGTGAAGAAACTGTGCGTATGTGTTTCCAGATACTAATGCATACTCCATTCGTGCTGTTCTTTTACGTCCAGCAGAGAGTTTCTT
CGAGCACGATGGTCAAGCTGTGTGTGCGAAATGCAAACACGAAGCGATTGCGCTTGATGAACCGAGCGCCCCGTACGTTGTGGAACCAATGGGTTGGGGT
ACATCTTGCATTGATAAACTAACGCACCATATTTTTTGACAGCGATAAAATGGAGCCCGTGTCCAAGGGTATTGCTGGCTACCGGTTCGACGCGCAGGAT
GACACACAATTGACTATTTATCCGGGCGACGAAGTAGCAATCCTTCAAAAGGTTTGTTTCACTACATGGCGCACAGTGCGTAGTGCAAGAGCTCTTCTAA
CGCTGTATCTTATGTGACAGGACGACGATGGCTGGTGGCTAGTGGAATTGAGGAACAAACGTGGCTACGTGCCGGGTTCGTACTTGATCGAGCGCCCTAT
CGAAGAGCCGAAGCCACAaccaaagaagaagaagagtgcGTTCAAGAGCAAATCGAAGCGCAAACCCGGACTGTGTAGCTCGTGTTCGACACAGAATCCT
GCCGATGCTCGCttttgcaggagctgcgGAAACAACCTGATGGATTAAAA