Description :
From Genome Similarity Track
Location :
Scaffold_758:884- 2572
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_758-snap-gene-0.8Endo-1,3(4)-beta-glucanase

Sequence
1688 bases(100 bases per row)
CGTCGCCGCCATGTAGAGCGCCCACGAGCGCGTCAGTCCGTCGTCCATCGTCGCCGTCTGGAGCTTCGTCATCGCCACGTCCTTGTTTACCGTCGCATAA
TTGGCGTACAGCAGCGAGAGCCACGAGTTAGTCATGTCGTTGTTCAGCACGATTGCCTCGCGCGCGAGCACTTGATTCCACTCCTCCTCAACAAACTGAC
GCGAGCGGACGTACTCGGTCACGGGCGAGATCGGGATCATCTGGATACCGTGGATTGCGTATTTCTCGGGGCTAAACCACGTGGCATAGTCAATTTTGTT
GTCGAACATGATGCCCGTGACCTTGTTGGGGCGGATCTGCGCTGGTTGCGCCACGTTCGCGTCTGTCATGAGAAAGTACGTCTTGATGGCGCGGACATCC
AGCTTGAGCATCAACTTGCCGATGCGAGTGAGCTCCGCGTCGTTCGTCACCTGGCCGAAGAGCACAAGTCCGTAGTGGAAGTTGACGTCCTCCGACGTGC
TCTCCTGGTCCTTGCCGTCTGCGAACGGAGTCACGCCGTGCGAGTACGAGTGGCCGCGGTACCAGTCAAAGTTGCGGAACTTTGGGAAGTACGTGTCGCT
CCACGACGGGTTCGCAACATCGCGGATTAGGAAGCTGGTCATGCGGTTGAGCTCGGCAATGCGCGACCAGGTCGGCTCAAGGCGGTTCACGATCGCCGCC
GTGACGATCCAGTAGCCAAAGTGGTAGTGATGGTCATTGTACATGGTGTTGCCGAAGTCCGCGTTGATGTCGTTCTTCTTGAAGCCCTCCGAGCTCAAGA
TGCCGCGGTAGACCGTGTCGTAGCTCAGCGTGTTGGTCCACTTGTTCTCCAGGAACGGCACCAGGATGGTCTTGAGCTTTGTCAAACACTCACTACGAAG
TCCTGTGTCAGTGCCGACGATCGAGGTGTCGCTCGCCATCAGGCACAGGGACGCGTACTTCTGCGCAGCCTTGCCGTTGAAGTAGTAGCTCCCGTCAAGC
GGGATGCTCCATGCGGCTCGGATATCCGTCGTCAACGTTTCTTTGATCTTCTGCGCTGCGACAACACTCGCAGCAGGCTTACGCGGAGGGTAGAAGTCAA
CGGGGATGCTTGTCGTGTCGCTGAAGCGCCACACTGGAGGCGACGTCTTCGTCAGCAGCGCCGTCATCTTGCCGCGTGTGGTGGAGAACGCTTCAATCCC
GCTGGCTTCGGCAGCGCTCGTGCGGTCCAGCGTATCCACGTGGTGGATCTGGGCGTAGTGAAGCATGCCCGCGCCGCAGTTGCCGCTCGTCTTCCAGTTG
TACGAGTACGAGTTCTCGTCGCGCGCCTCGACATCTCCACCCTCAAGCACGCAGAAGCGTGCTTNNNNNNNNNNNNNNNNNNNAAAAATCGCTTGCTTGT
CCGCGCTCGGGATCATCGCGGTACGCACTGTGCCGGTGAAAAGCGACTGTCCGATCAACTTGGACATTCCGTCCACACGCAACGCAACACTTGAGGAGAA
GTAAAGTGTCCATCTCTGTCCGTTGTTGAGCTCCAGCACGAAACGGTCGCTGTTCGTCACCAACCCCGAGACCGCGTTCTGTCCATTGACGCTGATGATC
GCAAAGAGCGTCGAGAAGCTCGGCGTCAGCGCAGTGTATTTGGCAGTCGCGAACGCCATGCCGCTCACCAAGGTGGACTCGAACTTGC