Description :
From Genome Similarity Track
Location :
Scaffold_267:884- 2105
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_267-snap-gene-0.17CCR4-NOT transcription complex subunit

Sequence
1221 bases(100 bases per row)
TGCGGCTCTTGCCGACGAGAAGGAGTTCAAGCTTTTCGACAAGGTCCTCcACGTGGATGAGCGTACTGAGCGCAAGGGTACGTTGATATTGATTTGGCTT
CATCAACTCGGTGACaTAAGCTAACGGTGACTCATGTGTTACAGACAAGGACCGTGGCTTCCGctCGGACCGTGGCGGCCGTGGTGGTCGTGGCCCAAaG
GGCGGTCGCACAGGTGACCGTAAGGAGCGTGAGGACGGAAaGGAACGCCGaGAAGTgAACGGCAaGGCTCAAGCGTCGGCGAACGGCCCACGCAACAACG
GTGACCGCCGTGAGAAGGGCGGACGACGAtCCGGTAAGGAAGAAGGCGGCCGCGGCAACAAGGACTAGGAAGCACGACCAGACCGTATCATACAGACACA
CAGACACACACGAACAGCAGTAGCACCACACCACACACAACACAACACAATTGGGAGAGAGAAGAAGCCCATGGTGCCGACGGGGATTGGTAGGATGAGA
GCATTGCCATGCCGGACGCATTTGTTAGGTAGCGAGTCATTATGAGCCAATACAGCAAGTGGAAGAGTATGAACTTGCAAGGCGGAAGGGCAGTCTATTT
CATTACGATACCATCGATGCTGCTCTCCTTCGCACTTGGATCCCCTcACATTCGATTGTATCACACACAGGAACGGTTCGTCCTGGTGGATTTCCCGCGT
GCTTTATtCTCTCCTATCATGCTCACAGTGTACAGGCACTTTGGTTGACAAAACGCGTTCGTCGTCACGACTACGCAGCAACTTGCGCTTCTTTCAGGAC
GCGCAGCGCCTTCTTCGTGTCACCCTTCTTCAGATAGAAATACACCAAGAGCTCAAGCGACTCTCGACAGGATGCGTTCTCGCTCACAGCTCGAGACACA
CTCTCCTCGGCTTCTGCCACGCGACCCTGAAGGATCAGCGCTGTCGCATTGTTCACGTGGACCGCAGCACGGgCAGTGTTGACCTATTCAACAACATGGT
GTAATTATTAGTCCCAAAGTAACTCTTGTCTGGAGGACACAAACGCACCTGAATCTTAGCTTCACTTGCATACTGCTCCGCATTGTGCATGAGATCACGC
TCGGCCTGTAGCACCTGTGTTGCTtCTTGTGCGCGCGACAGCATACACAGTGCTTCTGCTGCATATGAGCGAGCAaGGAATCTGCGGCAaCAAACGATCA
GCCTCAGGATACGGTTATCTT