Description :
From Genome Similarity Track
Location :
contig_109:88395- 91054
Transcript NameFunction/comments
g11185.t1hypothetical protein
g11186.t1reverse transcriptase

Sequence
2659 bases(100 bases per row)
CACGCAAGAGAAGACGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGCGGCAGCTCACGCAA
GAGAAGACGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGCGGCAGCTCACGCAAGAGAAGA
CGCTAGAGCTGGCACAACTACAGCGGGACTACGTCCAGGCGTAGTACGCCGCATTGCAGACCCCTCGAGAGGGTGGTCGGACCAACGGTATTGGACATGC
TCACGGGCGAATACAAGGACGGCGGGAAGTTAGCTGTTCTGCCCGCGGTAGCAGAGCTACTGGAACTCGAAGAGCTCTCGTATGTCGAGTTTCTCGACTC
TCTGAAGGCGGGCGTGCTCGAGGAGATGGTCCTGATCCGACGCGAATTCGATTCGATCGAGCTCAACACCTCCTCGGTCATGGACCCCGAGGTGTTGGAA
GACGAGAGGACCTCCTCGCGGCAGAAACGATATGGCGCGGCCATTTTGAAAGACCCGTCGGATCCGTACTACCCCCTTTTGAAGGAGTTCTCGGATGTGG
TCAGCGATAACCCACCGTCGGTGTTACCTCCAGATCGAGGTGTGCGACACGAGATCGATTTGGTGCCGGGCACCAAATATTGCACCACGCGCCAATGGCC
ACTACCGAAGGAGCAAGTCGATGTGATCGACGCATTCTTCGCGGCGAAATATGCCGCGGGCATGGTGCGCGAGTCAAAGTCGCCGCACTCGTCTCCGACG
TTTTGCGTGCGTAAACCCAATGGGAAGTGGCGTATGGTACATGCGTTCAACAAGTTGAATGCAGCAACCATCCCGGCGTCCACGCCAATCCCTCGCAAGG
ACGTGTTACAGAACAACATGGCGGGCTGCACCATCTTCAGTGCACTCGACATGGTCGATGGCTACTATCAGCTGCTGATGCGGGAATCAGACGTCCCGCT
CACAGCGGTGAGCACACCCAGCGGGATGCTGTGGGAATGGCTCGTGATGCCCCAGGGGCTGTCGAACGCACCAGCCACGTTCAATCGATTGGTGACTCAA
CTCTTCCGGCCGATGCGGCAGTTCGTACAGACGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGACAAGACGGCTGTCGAAGTGCACGTTA
ACCACCTCCGCGAGGTATTGATGTGCATGCGCGAGAATCGCTTGTATGCGAACATCAACAAGTGTATCTTCGGAGCCGAGGAGATTCCCTTCTTGGGATG
TTTCCTTGGCAAGGATGGTGTCCGTGCGGACCCTGAGAAGATATGCGCGATCGCACAATGGCCAGTGCCAGTATCCCAGAAGGACTTGCGCAAGTGGCTT
GGCCTTGCCAACTACTTACACAAGTACAGCGCCAACTACGCTGAGATGGCACGGCCACTGACGAACCTCTTAAAGAAGGAGGCGGAATGGTCGTGGAACG
ATGAAGCCCAGCAGGCTTTCGAGGCAATCAAAAGCAGCCTGCAGAGCGCTCCGATTTTGGCTTTGCCCGACGATGATCGTCCTTCAGTGTGGTATGCGAC
GCATCCGACTTCGCCATAGGCTGTGCCCTGCTGCAGGTCGATGCCGATGGCAGAGAACGGGTAGTATCTTTCCAGTCGCGCCAACTCAAGGCGGCTGAAA
AGAACTACCCTGTCCATGACAAGGAGCTTCTGGCGATGAAGTACGCGCTCGTAAAGTTTCGGGTACACCTGCTTGGCAGCGAACCCTTCGTGATCTACAC
AGATCATGCGTCTTTGCGGACAGCGACGTCGTCGCCCCACCTCTCCAGCGTATGGCGAGGTGGCTCTCCTTCTTTGCGGAGTATAACTTCACGGTGGAGT
ACAAACCAGGGAAGCAGAACGTCCTCGCGGACGCGTTGTCCCGGCGCCCGGACTATGAGCTGGCGCACGTTGCGTATCTCGAGTCCCCACTCTATGAGCT
GCTACGCGAGGCGTACGCAGAGGATGGCGATCTCGCCGATCTCGTAACTTCACTGAAGGTGCCTGAAAAGGCTGTGAAACTCACAGCTCGGCAGCGCTCA
CGGTTGCACCGCTACTCACTAGCGGACGGTCTCCTCTACTATCAGGTAGACGAAAGCGACGAGCCCCGTATCGTGGTTCCCAACGACGAGAACTTACGTC
ATCGAGTCCTCTACGAGGCACACGACACGCCGCTCAGCGGCATCTTGGCCGAGAGAAGACGTATACGTCTGTGGCGCGCAACTTCTGGTGGCCACATATG
TATAAGTGGGTGCGCACGTACGTGCAGACGTGTGAGACGTGCAACGCGTGAAGCCCGCCCCATCGTCGTCGGCTCCATTGATGAGCTTGCCGGTGCCGGC
TGACTGTTGGCGCTCGGTGAGCATGGATTTCATCTTTGAGCTTCCGGCGGACACGCGCGGCCACACTGGCATCTTGGTCTTCGTCTGCCGACTGAGCAAG
ATGGTGCGGCTTGTCGCGGTGAAGAAGAGCGTGACGGCGCCGCAAGCGGCACAGCTCTTCGTCGATAATGTCTTTCGACACCATGGCCTCCCGGAGGCGT
TCGTGAGTGATCGAGATCCGCGCTTTGTGTCACACTTTTGGACACACTTGTTCCGTCTT