Description :
From Genome Similarity Track
Location :
Scaffold_269:8839- 13069
Sequence
4230 bases(100 bases per row)
CCAAGACTTTGCGGTCTATGGAGCAGCGCTGTACCAGCTTAAGGACGAGGACTTCCAGCCCGGGGGGTGACCTCATCGCGGCCAAGCACAGCTTCGCGAT
GCTCCAACAGAAGGTTTCGGCAGCACCGATACTACGACACTTCGACCTGAAGAAGGAAGTGCATGTCATGTTGTTCGCCAACGAGTGGGCTCTAAGTTCC
ACGTTGATGCAAGAGCACGAGGGCAAACTACACCCCGTTCGCTTTTGCGGACGGGTTTTGAAGGATGCTGAGATGAATTATCACCCGGCCGAGAAAGAGG
TCCTCGCGCTTCTGCTGATACTGAAGGTGTGTTATACTCAACTCGTTGGACAGCGAATCCGGGTCTACACTCGGTTTTCGACACTCGACTAGGTCCACAA
GTCCAAGACATTGTTCGGTCGGGCTACCCAGTTCACCGTCTTGCTGTCGCCGTGGCACCTGTTGGTCGAACGAGTCAAAGAAACCGAGTGTTCGTTTGCT
CAGCTACTTCAAACCGGCTTGACGAACTTCGTTGACTTGGATAAGTCACTGGCGTTGGTCACACCCCGGACACGAGGGTCACCAACTGCTCGTTTGGACC
CGCATCCGCTCTACGCACGCCTACCGCGGTCCTACCGAGGCTTCGTTATGTCGTTTGACGGGTCTGCGAAGACCGAGAAGAACGGTGGATACGGCAGTTG
TTCGTGGATACTATGGAAGCTACCAGACTGGACAGTAGTGCTTGCTGCGAGCGCTTACCTCGAGAACACCACGGTCAACCTCGCTGAGTACACCGGGATG
AACAACGGCGTCTCTGCTACATTACAACATGGAGCCGACGATCTAGTTGTCGTTGGCGACTCGAGGCTCGCGATCCAGCAAGCCCTAGGGGTGATAGCCT
GTCGGAAGGAGTCATTGCTGCAACAACTCTGCCACCACCAAGAACTCACGGCCAAGCTTCGGTCGGTGAAGTACCTGCATGTGGTGAGAGAGTTTAACGC
TGCGGCCGACTCTCTGGCAAGCGAGACTCTCGAGTGCAAGGAGTATACGGTGGTATCGTCGGACGACCGAGTATTAGAGCTGATGAAGCTGAACCGTATC
GCTGAAGTCATCTACGAGGCTGCTGACGGGTGCGTCGTCGAGGACATACCCTCGGCCAACACAGTATGGGCCGTGGTAGCTTCTGCCAAATCTCGTAGCA
AGAATTTTTTCGATTTTGTGCGAAGAGAAACCGACCGCAGACGGCAGAACAAGACTGAACCCGGACACGTAGCTGTGATGACCAGACGTCAAACGAGAGC
ACAGGAGAAACACGGCCGGTTTGCAGATGAAGTCTCGGTCACCGATCAGGGAGACGCATCTCACCGAGTAGAAGCCAATGGTGTGCCGAACGAGTCTCAA
AATGAAGCAGAAGCTTCACCGCTGCGTGCCGAGACGTCACCAGCCCCCCCGAACGCAGAAGACATTGACCCGCTGGTAGTACAGGAAGAACGCTGAAGGA
GAATCGCCTCCGCTCAAGATGAAGAGTTACGGTGGTCGAATCTGAAGGCAGTGCTCCGGGGAGATGATGCGAAGATTGGATACAGAGCAGCACGAGATGC
ATGGAAAATGGCGGACCAATTTGTGTTGAGCGAGGACGATGTGCTATATTACACAAGAACGAGCCGTCGTTCAAGTGACGGCGAGCAAGCCAAGTTGGAG
ATGAGACTCGTGGTGCCCACAACGATGATCCAAGAGGTCCTGCAAAGCTGTCATGACTCACTTGAAGGCGGTCATCAAGGTATTACCCGTACGCTACATC
GAGCGGCGAGAGACTATTACTGGATCGGCCAGTATGCCGATGTGGAGAAACACGTTAAGTCGTGCCCTGACTGCAGTTCAAGTAAGAGCCGACCTCAGTT
CCGCGGGTACTCGCCAGGGAACATCCTAGCCGAGAGACCCTTACAACTAGTCTCTATGGACTTCGTGATACCGCTACCGAAGAGTCGCCGTGGCAACACG
GCTCTCCTGCTATTCCAATGCTCGTTCACGGGATTCGTGGTGGTCAAAGCCATGTCTGACACTACCGCCTTACTCGTTGCGCAAGCTTTCGAGGAGTGTG
TCTACCGACGTTTTGGAGCACCGTCCTTGATCCGTCATGACCGAGATCCTCGATTTATGAGCGAGGTCTTCCAAGCCTTCGCGGAAATGATGCAGTCTCG
GTCGAGAGCGACCCTGTGCTACCGCCCGCAGGCCAACGGCCAGCAGGAGAGATCGGTGAAGACGATCATGCAGTCAGTCCGCGTATACGCTGAAGACCCA
CTACAGCAGCATTGGGACGAGATCGCCGAAAGACTGATCTTCGCCATCAATAGCTCCCGTGATACGACGAGGAAGGAAACTCCGTTTTACCTCGTTCATG
GGTGGGATGCACAGTCGACGCTCAAGGCAATGTCCTCGTCACTCAAACGAGGCTTCGGTAGCCAAACAGACGTGCTAGCATGGCGCCGAGAGGTCAACCG
ACAGCAGGAAATCACCCTGAGGATGGCCAAGGAGTACCAAGCCGCGGGAAAGGCTCGGAGAGCTGAAGAGCACAATGCGTCGCTTGGCAGGAAGGAGAAG
GAAGTCATGGCAGGCGTCAACGAGAATAGAACCTCGGTCGACCGGGCACCGAGTTCCCCTGACCATAGTAGAGCTGCAGTGACCACTGCAGCTCTACTAG
AGAACGAGGATCTCTTTGCAGCCCGGGAGCAGAGTGTGGCTGTACATGGAGCGGGTTCGACCAGGACTGACCAAGAAACTAGCTCATCGGTGGCACGGAC
CGTTCCGCGTGAAGAAGAAGGTCGACGAATTTGCGTATGAGTTGGAATTACCCGACCGAAGTGGATACCGGTTCTACCCGGTGGTGCATGTTTCACGACT
CAAGTCAGTGGACGAGTTCGAAGGCCGACCGAGGGTTCGTTTGGCTCGTGAGGTCACCGAAGACATTCGTCTTGACTTCGACGAGGAATTACTGCCTGAA
GACAGTTTTGAGCCGGACCGCCTGGACGGCGAGTATGAAGTCGAGGCTATCCTCGATGACCGGACACCGTTGTCAACGAGCACTGACCGGGCCGTCCGAG
AGTTCAAGGTGAAGTGGGTCGGCTATGACGAGCCGACATGGGAACCAGCGTCCAATCTCTCGTGCGGTGGCCTCCTGTACGATTACCTACGCCGGAAGCG
AAGCGACCGACGTTTGCAAATGGCCCAGGTGGCCGAAGAGGAGTAATTCTGCGCCCCAACGAGGATTGAACTGCTCGCGGGGGCAATCCAGCCCGCGATG
TCAGACGAACGAGGCTACTGGAGATGATGATTGAACTGCCTGCGAGGGCTATCCAGCTCGCAGTGACAGACGAAGAAAGTTACTGGAATCTGCATGTTAC
GTGTTAAGTGAAAGAGTCACGAGGGAATGGAGATATCGGAATGGAGCCAGGGACAACGGAAGACGCAAGCAAGCCTCGGTCAAACCCTCAACAGACGAAA
CAAGCGATGATGAAGCAAATGGGAGGGCGGCCGAGGCTTCGGACGCAGTGATTGCCATGGAAGTAGCACGAACAAGTGCGCTCGACTTCGCGGTTGAGTT
TGGAGTTGATGATGAAATGGGTATGCAAGCTGTCGACACCGGATACCCGCAGCAGACCGGGTGTACAGTTGTCAAAATTGGGCTGTCATGCGAAAACATA
CCCGCAACGGAGCTAGCGTAAGTACGCCCGGTCTCCCGCGAATCAAATCCGGTCTTCAACGAGCATAAGCCCGATCTTCTTGCAGAAAGACAAGACGAAG
CCCGGCTGTCGCAGCTACGAACCAAGCCTCGTTTGAGGCAGCCACAGCGGTCGAGGGCAGAGAAGAAGCTCTGGGAACCGCGACCGAGTATTGAATGCGA
TGTGCGTTGACGCGAGAAAGGATTATGAAATGGAACGAACAACATGACGTTATTTTGGATTGGGATAGCACATGCAGCGTCGCCTAAAGCGTCACGGACC
TCGGTCGACATTGGAAAAGAACGTGAACGAAACGGTGAAGCTGGAGCGGGGCCTAACGAGGCTAAATCTCCATCACAGCCTGAGCCAACACGCCCAGACT
TGACCCGACGGCGGAAGAAGCTTCACCCGACTCCTTCGTCTCCTCATCGGGGCTTGGAGAGCGAGAACGACGAGCGTTTACGAACTCGGCCACCCATGGA
GCGACCACCATCGAAGTCCGCAGAGAAGAT