Description :
From Genome Similarity Track
Location :
Scaffold_220:8839- 11398
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_220-abinit-gene-0.59Conserved gene of unknown function

Sequence
2559 bases(100 bases per row)
ACCTCAAGTACACGAATCTGATTGTGCGCGCTTTTGAGCCTTCTCTCGAGCGCTTTCGCTTCGTGTTCTGCATACTCGGCGCGACTTGAAAGCTTCAAAT
ACATGCCACCACGGCACCGGGTGGGTGGAGAGTCAGTATTCTGAGAAGAGCCGCAAGGATCATCCACAGAGCACTTACAGCAATGTCTTTGCGTTCGATT
TCGGCGTCCATCTCCTGATTCCGCTCCAGCAGTGTTTGCCCGATGCGCGCAGCCAGAAGGGCCTCTTCTCGGGACTCGGCCAACGCTCTGTGGAGTCCTT
CCACCTCCGTCTCGCGTGTCAGAAGCTGGTGGAGGCTGGCGAAGTCGCCAGGCGCACCCAATGTTCGTGATCTCCCGCGCGTGGCTCGACACTTTCGAGA
TGCGAGCGGTAGAGTCACGTCCGCATCTTTGGGACGGATCGGCAGCGAGATATCGTTCGCCTCTGGACACTCCTCGCTCGTTGACGCATTCGTTGGCGAG
CGCATGGTTGCACCGAGACACGGGCCCCTGACCGGTTCGCCTTGCTTTTCCCTTGCTCAATGACTAGGCGAAGATCCGATTCATGCAAGGGTCACAGCGG
CAGCAATGCTATCATTGCACGGACTGCGCGATTCCACACGAACGCCTGTTTTAGAACTGAAACGGATTTTCGGATAAGGTCTGACCAACAATAGCATGCA
CATTCGACAGCAAGGCAGTTCTACTCGTGTTGGCTGCCTTGATGAATGAGTGCTCGGCAGAAACAAGATCCTGTTCAATGCAGTGCGTACTATCGCCGCG
CCGTCCATCGATTGTTCGATTGACTGAGCATAGGGAACCAGGTCAATCATAATCTCCGTCACCGTAGCTTCGCGACTCCGATCACACAGTGGATATTGGT
GTTTATAAGTACTCTCGCCGAACTGGGACGATCAACGCCACCAAACACACTCGATTGCTTCAAAAGCAGTCAATAGGGCTCCAGTAGCTCGGCAAACGAA
TATCCAACTGGCCCATCTGCTGCCTCCACCCCATCATATCGAACTCCGTGCAGATCCACACACCTTCGCGATTGACACCTGGTTGAACGATATCTCATTC
GCATCTACATTCAGCTAGTCTCTACGTCAGCCGACTCGCCCTCGACCGCAGCGAGCTGCTCCTTCTCCTTCCGGATCTTCTTGCAGCTCGATTTGTGGTT
CGGCCAGTCCTCGATCTGGTGCTCCTTGCAGCAGTAGTACGCCGCTTCGCACGCGCACCGCAGCAAGCCGCTCGATTCCTCGCCTTGGCGAGTCGACGAG
CCACACAACCGACAGCCGACCTCAGCGGCGGACACCTCGCCCACCATCACCTGGTGGAGGAACATGCTCTCGAACGTGTGCGCCACGTTGGTGAGCAGCG
AGTAGATGACCTGCTGCCGCATCTGCAGCGTGAGCCACACGTCGGCCTCCATCAGCTTGCCTTGCGCGATCAGTGCCTTCTTCTCCTCGACCACCTCGGG
TGACGCCGACGGCAACAGTGACTGCACGTTGTGCTCCGGGTCGCTCAGGTCGATGAAGGCGAGCGCGACCGACTTGAACGTCTCGCCCGAGAAGGTCGGC
ATCTTGCCTTCGCTGCGCAGCGACATGAGGTACACGAGGTCGTGCCGGCTGCAGTCCTCAGTGCGCGTCGCGCGCGCGTTCATGAGCCGCAGGAACACCT
TGCCGTTCTCCTCCAGCAGCGCCTTGAGCGTCAGTTCGGGCGTCAGCCGCTGCGACGCTGTCGCGTGGCGGTCCTCGCCAGTCGGGTACTCGGTCGGCAG
ATCCGGACACGCGTTGCGCAGCAGAGAGACCTGCCCGGCGTACGGCAGCGCCAGGAACCAGCGCATGAACGCGGACGCATGCGCGCGCCAGAAGCGCAGC
AGGAACTGCGCGTGCGACTCGTCGCCGGCGGCGCTCGAGTCGCCGGGTGCGCCAGCCATCTTGGACAGACAATGGGCAGCCGCACAAAAATGACTTGGAG
GAGTCGCTTTTTGCAATTTGTGGTTTGCTGGAGATGATGCTATTCAATTACTGTTTTCCGCACATTCGAGACTGATGGTTTTCAGTAATTGCGATGGAAG
CGAGTGTGGGACGAAACGCCAAAATGACGTAGCGAACTGGATAGCTGGTGCGGAAACCGACGCGATTCAGATCGAATGAACCTAAATGGGGTAAACACGG
CCGAGACAAGTATTACGGCAGAATCCATCGGACACTCGTGCAATCGAAACGAATGACCCTGTGTCCTGTATTCCTATACCCGATGATTGTTCAAAGGAGC
TAATCAAAGCGTCAAAATGCAGTGCGATGCAGATCATGGAGCAGCGCGCGGGCATCTGACCCGCTCACGCCGCCATGCGCAACGTACGGTACAGTAAACG
TGATGATCAATGGCTCCAGCTCAACTGTGGGACCAGCTAGAAGCGCGAGCTGAGCCATCCAGGAGACCGTGGACCACGTTGAAAGATCACTGAAAATCCA
GTCGGTGCAGTGGTAGTACCCGGAAATGGCACCGCGCGAGGCGTTGTTTCAATGCAAGC