Description :
From Genome Similarity Track
Location :
contig_60:88387- 89534
Transcript NameFunction/comments
g9058.t1hypothetical protein

Sequence
1147 bases(100 bases per row)
GACGTGCCGCCGCACGTGTTCGCCACGGCTGAGGAGACATACCGCACGATGCTCAGCGAGGAGGACAACCAGTGCGTCATCATCAGCGGCGAGAGCGGCG
CCGGTAAGACTGAAGCCTCCAAGCAGATCCAGAACTACATCGCGGGCGTCAGCGGCAGCGGCGCAGGCGTCGACAAGGTGAAGCGCACCTTCCTGGAGAG
CAACCCGCTGCTCGAGGCCTTTGGCAACGCCAAGACGCTGCGCAACAACAACTCGAGCCGCTTCGGGAAGTACTTCGAGCTGCTCTTCGACTCGGCTGGA
CGACCGCAGGGTGGCAAAGTCACCAACTACCTGCTGGAGAAGTCGCGCGTTGTCAAGCCGGGCAAAGGAGAGCGGAACTTTCACATCTTCTACCAGGTGC
TAGCCGGACTGCCCTCTGCTGCCAAACAGAAGCTGCACTTGGCTCGGGGGGTCCAGAGAGCTACCAGTACTTGAAGGCTAGTGGATGCTACGATGTCGAC
GACGTGAACGACGCGCAGGAATTTGACGAGACCATGGCAGCCATGCAGCACGTAGGGATCAAGAGAAAACAGATTGAACTCGTGATACAGACGCTGGCGG
CCGTGCTGCATATTGGCAACGTACACTTCCAGCCAGAGACCGTGGGGGATGCGGAAGGATCGTCCGTGCGCGACCGCGAGAGTCTGCAGATTGCGTGTGA
CCTACTGGGACTGGACGCTGCCCGTCTGGAACACGCTCTGTGTTACAAGCTGTTGCAGACGATGGCGCCTGGAGGCAAAGTCGAGTCATACGAGGTGCCG
CAGAACACGAGTCAGGCGAAGTCTCAGCGCGACTCCATCGCCAAGGCTGTTTATGACCGACTGTTTGATTTCTTGGTGGAGCGTGTGAACCACGCGCTGG
ACATTGAAAAGAAGGCGGAGAAGCATGGAGATCCTGGAGATCGACGATATGACCACGATTGGTATCCTGGATATCTATGGTTTTGAAATCTTTGACAAGA
ACGGGTTCGAGCAGTTCTGCATCAATTACGTCAACGAAAAGCTGCAGCAGATTTTCATCGAGCTCACGCTGAAGAGTGAGCAGGAGGAATACGCTCGCGA
AGGTATCGCTTGGGCCCCGATCCCGTTCTTCAACAACAAGGTCGTGT