Description :
From Genome Similarity Track
Location :
contig_79:88382- 94521
Transcript NameFunction/comments
g12599.t1hypothetical protein

Sequence
6139 bases(100 bases per row)
TTCATTACGTGCACACGCGCTCCAACCGCTTGTGTGTCGTGGGTGTGGCGGCCTCCCACCCGCTCAGTGGTGAAATATGACCTAAAACAAATTGAAATTT
AAGAATGCAGACTGGGTTACTGGCTTGTACACTCTTGCTTAGCCCGACAGAAGCCAAACTGTCGTCAACATTTCCTGTCGTCTTTAAAAGCATGCACGAA
CGGCGAAAACTTCGGGCGGAAACTCCTGGTACCTCAGTCACAACAGTAGTTTCAATGTTGTAAGTACTGTAAAACCATGCCGCTCCAGCGGATATCGGTT
GGGTAGCCCATAGACGCTTGGACAACGCTAGGAGAGACCTTACGTAGGACGAAATGGCCGGTGGATTGTGGCCAATCGGTCCTTAGTTTGTAAAAAGGTA
GCTCAAATCGGAAGTCCTTCGTAAGACTTGCTTTACCTACATTCATTGGATAATACTCATGAAACTACTGTGATTTGATTGGGTGAATATGTATTTTGTC
TTGCCTCCTGTCATTAAATCTGCGGTGGCAACTTGGCAAATCCAACCTATACACCTAACCCCTCTTGCTTAGGACCTACCTTTTGGGGTCAGATTGGACA
AAAGTCGAGAAAGGCACAATAGATTCATCAAACTCACACACGAAAGCAATATAATAATAACTAGTATGGCAGCAAGCTGCCAGCATCCTCACGTAGGTAC
GCTCCGGTTGCTAAGGGGGGCGTTGCTGGTAGAAGTATGCAATATTGTAGTATTCAGCACCCCCCCTAACCCTTCTAACCCGAGCTCTTATTCTGTATCC
TACAGAATAAGCAATCATCTTCATTAAAGTATACTTCAAAACCTGCGAAAAGTATGCTGTTGTAAGCACTTTCGCTCTCAATAATCAAAACTCGGCCACA
TTTGGCACAAATATGCACCATAAATGGTCATAGCATTTACAATGTATCCAGCATCTGCGACGATAGCGATTTTCTATTGGCCCCCTGGAGGATAGAGCAC
GGTCATAACCCGCCTTCCAGCAATACCTGGCCTTTTCGTTATGACCGGCGGTCTTGCTCAGCCAACCACCCATCCTTGGCGCCAACAAGTCGCCCGCCCA
CCCCAGGGCGCGCGCAGAGGAAGAATTTGCCCAGTTTCTAACTAACGAATTAGTGAGGAGGAACAGGGCAATTTCTCCTCTGCGCGCGATCAAGAACGAC
AAGGTAAGTGTAACCGCGTAGATGCGGCCCTTCACTAAGCTTACTCCTCCTCTTCGGTCTCTCTCTTTCGCTTGCGGAACCTTATCTTCTTTTTCAAGCT
AGGTGGAATGTTCTTACCGTCGCCCCACGTGTCATGCCATATCTGCGAGCACGTGAGCGTGTTGCCGCTCTCGGCGCGCCGCACGTGGCGGCAGAGAGGC
ACGCGCCCTCCAAATGCATCAGTGCACTGCGGACAGTAGAAGCTCGTTTCGAATGACTTGGCCTTGCTATCGGTATACGCTGAGCAAACCTTACACAGGT
ACTGCCTGCGTTTATGGTGCTTGCTGGAGGGGTAGAAATTGTCCGTGTTTACTAATGTGTGCTGCTAGCGAGGTATCGGCACCGACACCAAGTCTTCAGC
GTTGGGATGTGTCTCGAAGTGGATTGTCCGCAGCGCCAGCAACTGGGTGTGCAAGCGGCGCAAGTACTCAGCATGGGTAGGTGTCTTTTCTCCTTTCTTC
TTGACAGTTGACACGAGGCGATCTTGAGTTTCGCGTTCGCAGCTGCGCCGTCCGGTCTGTACCCATCAAAATCAAGTGGGAGAGAAGATGATCCGGGATA
CAGCCACGTGCGTCACCCGAGTGACTGGCTTTCTAGAGACTGCAGCCAAGGCCGAGCAACCTGGACCCGTACAGGCCCCTGATGAGTACGTACATCCTGA
ATGAACCACCCAAGGCCGAGCCTGGAACGACTGTGTAGCGATGAACCTGGAAGGAGAGCCGAGTGATGAAGGCACAAGATGGCAGAAGCCTATACCTCCG
AAGGCGTGAAGGAAAGCGAGATCCGAGTTGGCGACGGACATCCCGAAGCGACGAGGACATCCCGAATGATCAAGTGACTTTCCGAATGAATCGACATCCC
GGATGAAGTTGAAGCTGCGTGACCCTCAGCCAATCAGCGAGTGACACGGCGTCCGACCAGCTGGCCAGGGGGCCAGTTTCAAGGTGTGCCCGGAGAAACG
CAATGCCGGTCCCACCGTCGGGATGGGCCGTGCTGCAGATCCCCATACAAACCGCAAGTGAGTCCAAGGGACCCCAAAGATATCAGCGTCGACATCTGAT
GTGTGCTCCGCTCCAGAGCCCGACGTGACGTTCGACGTGCAACCCACCATACTAAGACCAAGTCAACCTGAATGCGAGTGCGCGGACACGACGAAGAAGA
CCGCCAAGAATCCAGTAGACCAAGTCAGACAGAAGAAGAAGATAGTGATAAGAAGAAAACAGAGTTTGTTTTGCGTTGGAAGTGAGAAGTGGTGCCTTGT
CGGCCCCCTTGCTTTGAGCGTACTGCGTTGAGGAAGACTGCTGCGACCTATAGCGACTACTACGAGGCTGCGGCCCGGGAGCGCTGGCGTATCGGACGAC
CAAGACCGCACGAAGATCGAGGAACCCGTGCGAAAACTCTCACCTAAGTCTAAGTCCCATTTAGGTGGGGACCAGGAACTCGTATCCCTGGATTGATCCG
CCTATTTCATTTGTCAGTTGACTGTGGTTGCTTTAGAGTGACTGCTTTCATTTCATATTCACCTACGATTCGGGAGGTTATTAGCAATCCCCCCTGGATT
TTGATAGTAGATTGCTGTGTGGTTCGAAGGAACTTGTATATTTCTCCCATCCGGGAGTGGTGCGCGGAGGCATCCCGAATTTACCTGTATTCGGGACTGT
AACTCATTCGGACAGGCTGTATATTGTGAGTGTATAACAAACTCTGTTGTTGTTTCTGTATTGCTTTTGGTTATATTGGAGAAGGTCTTTGTTCGTGACC
CCACTCCCAGCCAAGACACTCCAGACTGTTAGAGTCTGGTAGTCTCTCTACATATCTACGTTTCCTAATCGAAGAACATCCCAAACGTCAAAGCCCGGTC
CGTCGAAGATAAACGACACCGATAGAGATTACTTCAAGGTCACACGCCAAATCTCGGGGCAGACACTAGTTGTCTGCATTCGGGATTCTGACCCCGGCAT
CCGGACGCTCCCTCCTAGAGGAATGGGTACTACCCGAAGCGTTCGGGTCGTCTGAGTTCTCGAAGCTCGTTCGTCTGCCGGCACGACTGTACACCCTGGA
CGATAAAGGCGTTCACCCGCCTCGCCTCACAGTGATGCAATGAACGATGTATCCATTGACAACAGCCATGTCTACGATGCACAGGAATAACTGCTTGTAG
TACTTCCGCAGCGAAATACACCTTTGGATGCTGTAGCGCTAGAGGCGGAGCTGGTCGTGAACTATCGCCGCCCATATCGAGGCCGTAGTCCCCGACCAGC
TGTGGGCATGGCACCGTGCTGCGTGTTCCATCCTTCTCCGTGCGCAGAACGCTGGTGAGATGTGTGCTACAACCAGTTGCAAGCATGTTCACAGGCTTTG
GACCCATCCAGCTTAGTGCAACAAGCTGAGGATGATCGCGCGCTTGTGCGATACGATACGTTCCTCGTGGCATTCGTTTCGGTCGTTTTTTCTGCGTGAA
GTGGATCGGACACCAGCCCAAGCGATCAACCCGTGTGGTGTCAACGTGGTACAGATCCATTTCTAGGAGCTTCAAGCTCAGCGACACCGTGGAGTAAAAT
CTATCGGTTACAATCAGACGCTTCATCGGCTGGTTGATCAACGCCTTCGAGATGTTCGGCACGACGGCCTTCGGTCCTAGCCCCAATGTATCACTAGGTG
CTATCTTCGTCTTCTTTTTGTGTTTATCCGCCCCACAGTAGATTTCAACTCTAAGTCGTGCATATACATAATACCATTAGTACCGATTAGGTTTTTTTGT
ATGTTCCAGAGTAACAAAGTTTACCTCGAGCAATAAGCGCCTCAGCACAACACGTCAGGTAGAACTTGGTGCCATACTTGCTAGACATGTCCGGCATGAA
AACGCGCATCGGGTTGAACTTGCTGCGGTTCGGCATCATGCCTTCATCAAAAGAGATTCCAAGTCGATATCCACGGCGACATGTTTTTTCAACTGCTTGC
AAAAGCGGCCGAACCTTCCACGCCTTGTCAGTCTGCGCACCACCGTCTCCATTGTTGTTGAAGTGAAGAAATTTCATGATGACCTCGAAGCGATCGCGCT
TCATGAAGCGTGAGAATGTTCCACGTGGTATAGCCCCATCCTCTTCGGTACACCAGTGATTGGAGAGGCCGTCTCGAATCGGAGCTATTGCTCTAGCAAA
GAGCAAAGCTATAACATGCACGATCTCATGAGCCTGAATAGGCTTGAACTTGTTCAGGCTTTCTTCAATATCCTCCAAGTTGGGCACACTCACGCGAGGA
TCCTTGACCTAGTTTGTCTCGCCGAGAAGTAGCAATGGCGCTGATATTCTGCGTTCGGTAGCGGTTCGTCTCCTTGGTGATGCGTATCCATAGCTCCTTT
GGTAAGAAGTAGAAAAACATACCCAACGGAGAGTCTGCGTACGCGACAGCCGATCTTGTGGGGCCACATTGGCCGTCGTAATAGTCCGTTGCAGCATCAA
CTCGGAGATTGTCTTCATCGTCACAAATACATACCATCCAGAATTAGACCAATTGCAATGCAGGTTATTCTGTACCATCCGTCTTTCCGATTTGATGTTC
GTCATACGTTGTCCACCCCGACTCAGCAATGTCTCGGAGATCATCATCCGTCCAGTCAAAAAGCCCGATTTCGGGATCATCATCATTCAATGGCACATCC
GCTAAGTCTTCTACCCCTTCTACGAGTGCAGGTGCGGTCACATTGTCGGCCATGACGTCTTCGTCGTCCGCATCTGACTCTGAATCACTCAAATCTCCAG
TAATCGTTACGTTCACGTCGTCATCGGCTGTTGGGCCGAGCAATCGTTCCTTTCGCAGACCCTCCATGAAGTTCTCGCCATCAAACACAGCCAAATCAAC
GCGGTCTGGTTCGGCTCGTCGCTCTCGCTTTTTGCTTCTTCAGCATCTGTCACGCTTTCCCTTGATTGATATTCCGGATAGTCTGGAATAGCGTCATCCG
TAATACCATCTTGCTCTGTATCATCCGTTGTAGGCGCTTTGCGTAGTCGTTGCAACTGCCATCACTGTCGCTTCGACCACCTCCGCTGATCCTTGGACAC
TTGTAGTAGCACGACCACGAACAACAGTCGACCTGGTCCCCTCAACCACTACTGGTATCGAATAAGCTGAGTTCGACGGTGTGGGAGCCGAGGCTTGATC
GCGAGGCGGCAGCTGACCTATGGATGCGTACGACGCTTGCTTACCAACAGGAGCTCGGGCAGACGTATTCAAGGTAGGATGATATGGCGTGGGTAGTCCG
AGGCGCCCGGATCGACGGCCAAAATCCATCAGCTCAGCTTCACCCAGGAAATTAATCGTTAGGTCATGATCAATATATATGAGGCAACATGCCCACCCAC
CTTCAAAGAAGTCTGTTCCGCGTCTTGATTCATCCAAGCGACCATGATTCGTGGCTTCACGTAGCGATGGTCCTTGGCCATGCTCGTAGGCTTGCGGGGC
TTCAATCCTTCCTTGCATAGCTCGCGCCATAGCTGCTTGAACGTCTTCTCTCGGGGCCGTTCATCTTTCCACAATGAGGGGAGTGAGCGTGTGGCTGACA
CACGGTTGCTTTGGGCTGCTGGCAGGATTTTCAAACCTGTTCGTGATTTATATTCGTCTTTCTATCACCAAGGAAGATTCCCCGTCTATCTACCCATCGC
CAATCCGACAAGAAGGATCTGCTGGCCCTCAATCATACAGAAAGCTATATGCGAAGTTTAGGCCGTCAAGTTTGCTGGATATTAAATCCTGTCAAATTGC
TTATTCTGTAGGATACAGAATACCGTGCTAGAGGGGTTAACGCGATACTGACGCCTTTCGAAATTCTCTTTTATCCCCGTCACGCACCCGCTTCAGATCC
ACCAGGGAGAGATGGAGGGAGGTACGTCGCTGTGTGTGA