Description :
From Genome Similarity Track
Location :
scaffold_7:88363- 97188
Transcript NameFunction/comments
Pl_112718conserved hypothetical protein
Pl_112719hypothetical protein PHYSODRAFT_507596
Pl_112720hypothetical protein PHYSODRAFT_302410
Pl_112721conserved hypothetical protein
Pl_112722nuclear pore complex protein Nup93-like protein

Sequence
8825 bases(100 bases per row)
ACATGGCGAAGACGTTGATTCTGCTTGGCGACTGACGTTCGCAACTGACGGTGGATAAAGCTGGCTGCCGAAAGAGTGATGGGCACAGGACGGTCTATGT
GTGCCACACAGACACGACAGCCAATCAGCGCGTCGAACGAGGTACGCGACGTTTGGGGAAAATACCATCGAATTTGACAAGGTGTCTGCAGACACGTGCA
CGTTTCAGACTTTAGAGCTTGGAGCACTGATAAACATACGGGATAGAGCACACAGAAAAATGCATCGTTTAGCAAAAATCAACGCATAACGGTGAATGCG
TCAGTATCGTACTTAGTCGAGTAACTACGGTGAAAACCCGTTGTGAAGTTGAAGTGGTCACAAGTCGATCTTGCGAAGAGATGGAAGGTCTCGATGCCAG
TTACGCCTTACTGAGCGATGTCAATGCCCGGAACCGTGAATTGCAGGCAAGACTGCGCAGTAGCTTACCGCTACTATGGACGAATAATGCACTGGTGATG
AAGAGCGCCACAGCGCCACGGAGACGACGTGGCGCTGAACGAGCGGGGGACAGTGAAGCAGATCAAATGCTGCTGGCTCTAGAAGGTCACGCGAGTCTCC
AGGTCAGTCGACGATACAAACGTCGTGTGGAGTGGGAGGTGGCGAGACGCATCGCACGCGTCGACCGAGAACTGCAGCAGTATCCGCCAGCGCAGCGGTT
CTGGAATCAAAGGAGGAAGGAACCGACACCTCGACAGTCTTCGTCTTATAAACAGCGTGTTAATACAATAGAGAAGGTGGGAACTACAGGTGTGCGACAG
AAACAGACTGTGGGGAAGACTGGTACTCAGCAGGAGAAAAGATTTTTTGTGAAGCCAAAGGTTTGGGTGGAGACTAGTGAAGAAAAACGCGTAGTCAAGC
ACGTAGCAACAAGTCCTCTCCGTGATGGTGAGATCGAAGAAAAGGAAAACGTGATGCCAAATGCAGCGACCAGAACTCAGATCGGAGAAAGAAATGAAAC
AAGGGAGACGAAGGAGTTATCTTTATGGAAGGATGTTACAGCGATGAAAAAGGTGGCTAACGATTTACTCGATGAAAAAGCAATACTTGGGGACAAAATG
AAGGAAAGTCATTCTGACGATCCTGTGGCTGTTCACGAGCCAATTGATAATGAATTATCAAGTGGACGAGGAGATCAAAGTTCAGATAGTCCTCATCCAG
CTCCTAGCTCTCAGGCAGGCACGATTGCAGATATTCACCAAGATAGCAACCATGAGAATACTTTCGAAATTGAGGAAAGCAGCCCTCGGATCAAGATTCC
ATCAGAAGAGCGTCCCTCGTCGTCCATTGGGAGACAAGTTTTGTCAGAGTTCCGCACAATGCCGTCGGTAGCATCATTTGGCGCGCAACCTATGCTTTCT
GTTGGTGGATTGGGAAACCCAGGGGATATGCGTTTGAATGTAGACGTTCTTCGACGACTTTTTAGCGACTTGGATACTGACAAAGATGGTCACGTGAATC
GTATTGAAACATGCATGGCTCTCCATCGATTGCAGATTTCCGTTCCGACTACCAAAATCATATCGTTCTTTCGCCATATTCATTCTGGAAAAAGCGTTCG
CAGTCGTCGCACTCAACATCTCCCGATTAGTGAAGTAATTAACTACAAGGAATTCGTAGCTTTTGTCACTGCTGCATACGACCAGCAGCAGCAGCAAAAA
GCGAAACGGGGTAGAGCTCCTGCGAGGCACCAAGCTTGGAAGGAGAATCATGGCACCGATCCACCGCTATTCGTACCATCGACGTCTTTGCCGATATATT
CACATCCAACAAACACGCCAAGGACAACCCGATATGCACATGCGTCTATACCACTACGAGAAGAGCAAGTTCGAGTATATGAAGTTGATGATACGAATTC
TCATCAGGGGGTTGCAATTGAGAAAAAAGTGCTCCACGAAATTCCTGATATTTTGGTTAGCAAGATACTCGCCGACACTTCCAGCGCAGATAGCGTTGAA
GTCAATGCAGACGTTGTATCGGTCGTACGACGGAGCTTGGAATCTCTCGTTGGAAAAGAGGCAGTCGACGATAAGATCGTGAACGAAATCACTCAAGATT
TAATCAGTGAGAGGCTAAGAACCGTTGGGACCTTGAGCCAGGATGACATGTACGATGTCACTGGTTTAAAGAGAGCTGCCGCCTATTACAATGAGCAAGC
AATGCTAGGTGACATAGATTCCTGCTCTGTTGTTGAAGACTTGAGCTCCGAGGAATCGGTTAATTGGGTTGACGTTCTCACAGAAGAGCAAGTAAGCGGA
TTAGTGCAACATATTTGGAAAGACAGACAAGCTGCTCTTTATCATACACCTTTGGAATCTGTGAAAGACATACATGTCGAGGACCTCGCAGAGATACCAA
CAGATCAGAGTGTGAAATGGAAAGATGAAGCGACAGATACGAATGAATTTACTAATATCCTAACAGTCTCGGAAAAGGCTGTTCAAACATTCGATGGGGA
TCAAGAAATATCTGCATCTACCCCTGAAAGTACCCTTGAGGAGAATCGGAACGAAATAGCTGCTCCGATCCCAGCACCAGCGACTTCTGGCTCAATGCCA
TTATATTCTCCCCGGACGAACCTTGCTAGAGCACTGACGACTTCACTCAATGATTCTTTTGACGAATTGTTCAGTCCTGTAACATCGATCGGAATTTTGC
AGCGTCTCCGTCATCAGAGGCGGATGAATACAAACATGTTCGACAGACATCAGCAATATTCTTGTATGGACGAAGCAATGCAACAAAAGTCAAGTCTTAG
TGATGCAAACTGTGTTGACGACATAAATGCTATACAAATCGATGGGCTGGACAGAGGGAGCATATTTACTTCTGAAGAGGAGTGTGAAAGTGTTTCGTCT
TGCAGTGTGGGACAACAAGACCCCCTCAATCACGTAGTTGACAATCAGAATTTGATGTCGTTACCGACGACAGAATTCGTGCCTCTCACTCCAAAGGTGC
TGAACGTGGACGACCATGCGAGTAATGAAGGTGGCTTTGAACTCGCAAATAGTATTTCAACGAGTAGCAGTGGCTTCAGCTCGACCTCGAACTATTACAT
GCATGGCATGTGTCGAGAAATTGACCACCATCAGCGTTACACCAGGACTCGAACAATTCGAAGTCGCCGTCCGCACCGGCGTCAAAGACGGCTGCCTGTA
TCTGAGAGTAGTGTTCCAGATTCAAATTGGAGCGCAGAACTGTCGGAGGGCGAGTTTTCGCTGGAAGAAGCTTTGGATCTTAGTGATGGAGAGATATTTG
GAGAACGCAAGAAGCAATATATTAGACACAAGAACGAAGCTTCATATGTGAAAAGCAAAGATGACGATGACAGCCTCTACAGCTCTGTCGAATCCGGAGA
ATTACCGGCACTGGTACGTCTTGCAAGATGTTATTAGGTAGCCTGTCAAAAGTTCTTACTCCTTGTCCCTTTCCCTAATACGTAGATGAAAACTCATGCA
AACTTTCGCCATCAGCTCGTTGTTCAGTCGATTTCGTCGGTTGAATCTGGTGAACATGAAGATGGTACCGTTTTCGATTAGCAGGATGCAAGATGTACGA
GCAAGTGGACGGCAAAGTTACAGGGCAAATTCGCCCTCGCTACTCATACCACTGCCTTTCCCCTCAATTTCGTCCAAGTCTTCCAGTTCAAGCAGTGACG
TAATTTCTTGATCGGGACTTTCGGAACTATTGTCACCACCAAAAATATTCCCCATTTCTGCAGGAGGCTTTTTATCGATTCGAGATTGCTTCTCCTCCGT
TGCACTAGGAGCATCAGGGAAAATCGACTCTCGTGCACTTTTCACTTTCTTCGCGACTTTCATGCCAACATTCTGGCGCATTGGTGCGTCTTGGTCAGCA
GCCGGGCGCTTTGACAGGGTCATCACTCCCCCTTTAGAAATATCCGCTTTGCAATTATGTGCACTAGGCTGATGCTCTCCATCGCTATTCGTTCCCTGAA
TCACTTGGTCTTTCTGCGGTGAAGTCTCAGGAAGGAACTCAAGGTTCGTCGCAAGTTTTGAATCCCTTATGCGGTTGGTCCCTTTTTTCTGGCGCGCTTG
GCGACGACGTTGACGTTTAGCCTCTTCGTTCTCCATGTGCTGCTTCCACATAAGCTCAAGGCCGAATTTTTGCTGGAGTTCATCTCGCGCGTCGCCCAAG
TCAGCCTTCGACACAACCAAACAAAGCTCAACGAAGTGCCATTTTCAAACTATCCGACTACAAGAAAGGTACCTTTCCATCCTTTTGCGAATGGATGATA
GCTTCTACGGCCTCAGCTCGCGCCTCCAAAGGATCCTTTGTCGTAAATGCAACAGGTCGTGTAAGGATCGGATGGCAATGCATACTCGTTTATTACAAAC
CTCCGGGAGCTGGATGTGTGCAGCTTCGCACTTGGAAATAAGCTCAACAAGCGTTCGCTGTGCCTGACGGCGATTCATCTTCGTCACACTCTGTCAAAGT
TTGAACTGTTGCAACAGAAGCTATGACACAAGCACTACTGGGACGAGGCCAAGCACTCAAATGTCTTGAAATGCGACGGCAAATTCCGTCGATGACATCG
CCAACTGCCATGTTGTGCTCGTTACCTAAAATCCAAAAACTCGAAACATGTTTGCCTTACTTGGTCACCGGCAGCGCTTCGTCGTCAACGTCGTACTCGC
TTAACGCCGCCGAGAGCCCTTCGTTTAGTAGTTGGTCCACTTTCGTCGCCACAGCTTGACCCACGCGGTCCAGTTTCTTTGCTTGAGCCCCTGAAGTGAT
GACGATTTTGCTGTCGCGAATCTCCTTCGCAGCTTTGAAACGGGCAATTCCACGCTGCGTGTATCCATGGGTCATCTCGAACTCGCCTAACTGCACGAGC
TGGTCCACTAGCGACTGGTTCGCATCTCGCGTGGCAGGCATGGCTTCAACCTGCTCTTGGATCCGACTCTTCTTTGGATACTTCGTCTTCTTCTTACTGC
TCGCGACAGGACTCATAACATTTGTTATTCCGGTCACGACAGAGTCATCATCGCTGCCACTCTCGCTCTCGAGAACTAGGTTACGTCGTTTGCGTTTGGG
CATGTCTTGCATAAGCGTGCGTCTCTGTTGGATCACCACTTGAGGTGACGTTGCCGTTATAGACATCGCCTCCACCTTCTCTTCTCCAGCTCTGTCAAAC
TTGTTTTTCAACAGCTCGAAAGCTTTCGGTATCTGCAAATACCCCAACGCCTTGTGCTTCGTCTTCTGCAATGCCGCAATGGCTTCGCGCAGTGCTTGCC
ACGGATTCTAGACAAACAAACAGTTGAGCATCTTAAAATGTTGACACGAAAATCTCATGTCAGGAATATCGTGTACTAACCTCAGGCAGCTGCACATGCT
GCTCCTCACATTTCATCAACAAGTCCGAAATCGCTGTTTCCGTCTTCATTCTCAGCAGCCTCGTACGTCCTCTGTCTCGAAATGATCGAATCGAACGCAG
CTTCAGAGAAGATGAAGAAAAAGCTCCACGCAACGTCTCACTTCAACTTGCCTTTGTGTACACCACCTAAACTGTGTCGACCACATCATCCCGATCTCGT
TTGAACGTTTGAATTTGAAAAAAGTCTTTTCGCCGCCATTTCTCCATTTTCATCTTATCAGTAATGCAGGACAGTGGGCTCTTCATGATGTCCCCCATGG
ACACCGCAGGCGAAGAGCGACTACGTCAAGCGCGTGCGTGTATCCGGAAGACGTTTGGACCAGGCGGCAGTGGACGCCGCACCAAGCGCACGTTGGAGAT
GGCGGGAGAGCCGCCTACATCCGCCAAGACGCCGCGTACGAAGCTCCGTCAGCGTATTGCCAAGGCCTCGCAGCTGAACACGGAGCAGATTTTCTTCCAG
GAGTTTGGCAGCTCTGAGGAGCTCATGAAAGAAGAATTTGACCTTGCTCGGCCGGCTGGATACCCCGCTAATAAGTACGCAGTAGAGGATGCAGCTTCTG
CCTCGACCCACTCACAACAGACAACAGGAGCCCCCACTAGCTACTTCTCCTTGACGTCGACTTCCGCCTCAGCGTTCACTAGCTCTCTACCGGCACCGTC
TACGGCAAATATGAGTCAATTGACGCGACCCACGCGGATCCGAACTCCACGCAAGGCGATTAAGCGAGGACGGGCAGGAGAGAGCAGTGCCGAGAAGGAA
CTCGTGCTGAGAAAACCTCGGCTTGGTGGTGCAAGTGCCAGAAGTATCAGTTATTCGAGTGCAGGTGCACCGACAGCTTCGTCGTCTTTTGAGTCCCGCA
AATCTTTTGCTTTTGTCACCAACCGTGGTGAACATCTGCAGCAGCCCAGTTCATCGAGATTCTTTTCGAGGACGTCACCGAGCAAGTTCCAGTTCTCGTC
GAACGCAACGAGGCTGTTCTCCCAGCGTCAGGCGCCGCTGCGATAATTTAACAACAATTCATATGAAGTGCTGATGGCAGACGAGCGAAAGCCTGACAAC
AGAAGGATGCAAGATTTATTGATCGTAAGTAGTAACCAGCGAGATGAGAGATCGACAAGTGTAGTTGTAGCCCGAAGAAGGAAACATTGTTGAGAACTGC
AAGTACAATACAAATTGCAGTCGCAAAAGCTTTCTTGTTCCTTCTGCAGGTATCCTATCATTTATGCATGGATGCAAGAATGATTTTCCTTTAACAACAG
GCATTCTAATAGATCATGGCCTCCATGCGGTTCAGCCGCTCGTTAGTGCCTGATGGTAGACGGAACTTAATCATGCCTGCAAATGTGACGAGGAGCTCGG
CCTTTTCGCGCAGAGCAGCGACACCGACACGTCGGACTTCGCCTGTAACCTGAGTCTTGAGGCGGTCTGCATCACGCACAAGGCACTCCATGTATCCAAG
CAGCAGAATGTGAAAGTTCTGTCGCACACTCTCGTCAAAGGCGAGGAAACGATCCACACAGAGCGCCAAGTTGCTCGAGTTCTGGGTAGGAACAACCTCT
AATTCATCAACAAACGCGATGGCGTCCTCGTACTGCTGCTTCTCGAATATCTCGAGGAAGATGCTGATGTTCAGGAGTGTCTGGAATGCAATAGCCGCAG
TGCGTGCATGTCGGTTCGCAATAGTCTGGACCCACGGGAAGCGCATCCACTTCTCAGCAAACTCCTTTGCCTCACGAAACCATTCCTCGCGCTCAGGTCT
TGTGGCTGACAAAGTCGAGCTGAGTTGCGTGTTAAGCAACACAATAACACCTTCAATATCGCCAGCGCTCTTCAACAACGCAAACGCGTCATGTGGGCGA
CCGCGAGCCTCAGCCTTGCGTGCAGCTGACAGAATTAGTTCCTTGACTTCGTCTTCAGGCTCATCCTTGAGCAGATGGTCATATAGTCCGCGAGTGCGCG
AGCCGTCTGCGTTGTTAGCGAATCCGGCCAGGACATCGAACTTCCGCGTATCAAGCAACAGCTCCGCGAACAATTCCTTTTTCGCTGTCAAATCCGACAT
GGTAGCCACATAGTCTGCAGCCTCCGCCGCATTAGCACGTTGGAACCCGTGAATGTACTGGCGGACAAGACGCACAAGGTCGACAGTAGTCTCATCTTCT
TCGCCCATTGAGAACGATGTGCACTCCAACAAACCATAGTGATTCAATGTGATCGCAAAATGTACTGCTTCCAGCAGAAAACCCTTAGAGGCCAGATATT
TAATTGCCTTCTCGTACTCCTGCGTGATAAGGAGAATCTCGAAATACAGGAATGCTGAGTAGTTACCTCCACCAGGCTGGGCACCTCCTTCAAAGTGCGA
TGGTCCAAACTTCTGCATACTTTTCGATAGTTTTGTAATTGTGTAAGTGCTGTCTGGTGCTGAACCAGTAGCTGCCACGCGTTGAATGAAACAAAGGCGC
TGCCACAGGTAATCTTCCACGGTAGTTGTGATGCGGGTCTCATTGGCATTGACATTGCCAAAGCACAACAGGTTCACAACGCTGCGCTCGAACGGGTTTA
TCACAGAGACTGCGTCAATTGAAGAGCTAACAAGGCGGTGGTAGCGATCCACCAAGCGCTCAAACTCAGCAGGAAATTGCTTCGAGAACGCGTTCAGTGG
GTTAGCACTGCGGTCTGCGTATAAGTTCTTCTGATGTGCGCGGTATCGCAATGCACACAGCAGGTCGCCGTCAATGGAAGAATCTTCACCCGTTGTCGAT
AGTTTGGTCACGAGGTTGACTGCTTCCTGGTCACCACCACAGCGGAGGCAGTAGTAGATAATGGCCCAGATATTGTCCACGTCGGTACTGCTGCCACTGC
CATTCGCAGCATAGCGCGAGCTGTGTAAGTGCTTCACGAACGCGCGAATCGTAGACACCAGGTCCGGAATACCACCTGTAGCAAGATTATTCTTCTGCAC
AGTTTCCTGCACAAAGGCGCGGAATTGGTTCTCAAGAAAAACGCGGGCGCCAAACGCGAAACGGTGCTGAAGCAGTGTGCGTTGAGTGTCATCGCTTCCC
TCTCTTACTGCAGTAAACTCGCGTTCTGCTAGTTTCATCGCGTTGGGTTTGGTGGCATCTCCGCCGATCAGCATGTCGTTCACCAGCTGCCAGCACTTAA
GCACTGCCTCCCACTTGGATCCGGTGACCGACAACGACACGTTCGATGAGCACACACGCTGAAAATGACGTGCGAGTTCAAACTGACTGCGTGTGTTGGG
TACGCGGCTGCTGTTGAGTTCTTTAATGACCGAATAGTACTGCTTCATCTCCTCCGTCATAGCATTCTCCACCTGAAGCTGCGACATATGCAGCGACTGC
GTTCCGAATGACGAGCTCGTGGATT