Description :
From Genome Similarity Track
Location :
Scaffold_187:88358- 89597
Transcript NameFunction/comments
Phyci_324895Hypothetical protein

Sequence
1239 bases(100 bases per row)
GCTCCAAAGACTGGCGCACCTGAAAATCACGTTCACGTCGCTTTCGTAGTGCGTCCGAACGCATCTTTTGCTCGGACTGACGGCGTTTCACAAAGCTCTG
AATGGGTGGAGGAGCGAGAAAACTTGACTTCGCGCGTGACTTCTTCTCAATGCGATACACGGCACTCTGTACCCGCACCCGCTCCTCGAACGACAGTTCT
TCGGTGTCGAAGAAGGTCTTGTATCGTTTAGCAATCGTCATCAGTAAGTTAGATGCTCCATCGCTGTCCTTCTGCTCTTCGGCCTTCCCAGCCCATTGGA
GTGCTCGCTCACGCTCCGATTTAATAGCACTCCAATCAACTGCAGACACAGAAGCAACTGCCAATGCTTCCTTCCTGTCAGCGCTTGATTCCTCGTCGCC
GCTGTCGCTATTGTCTAATACTAGGGAGCTCTCCCCAACAGCTTCAAGTTGCTTGCGAATCTTAGCGTAGTCCGGGAAGTCCTCGTACTTCAGCGACTGG
AGGTAGTCCATCATCTCGATCAACTGGGTGGCACCCGGGAGGCCCTCCACCAACAAGCTCGGGTTCTTCTCCGTAAAGTGTTCTTTGAGACTCAGCACAG
TCTGACGGTTCTTGAGCTGCGCATCAGCGGCCCACGGCAACTCGCCGCGCAAAAAGTCCATGACGAGGTAGAACCACGACCACAGATCATCCTTGGGGCC
CAGTTCCTGTCGACGATGTGAACTCAGCGACGCATACATGGACGTACCTCGGAACTCGGCCACCTGGCGAGCAGGCAGCACCTGTCGGTCCTCGTCAATG
TGCTGCCTCGACAGCCCGAAGTCGATGATGTAGTACCGCGCCTGCTTCATCGGGTTGCGCTCCGGAATAGCACTCAGCGCGAAGTTGGACGCCTTGATGT
CCCGATGCACGTAGCCGTGTCGGTGGAACGCCTCGATGCAGTCCAGCATCTCCAGCCCGACCGACACCGCCTTGGCCAGCGGCACTCCGTGGATCGAGTC
CGGCGACATCCGGAGCATGGACATGCTGTCGCCCAGCAGCTCCATCACCAGCACCGTGCTGTCTCCGTGCTTGCCGTGGTAGTAGTACCTGCACACGTAG
GGGCAGTCCTGCAGGCTCTTGAGGATCAAGCTCTCCCACTCCAGCACGGGCTTGAGAGAACTCGGCGCCTCCACCTTCACCGCCACCTTGTCCCGACTCT
CGATCGAGTACGCCGAGTAGATCTGGCTGAACGTGCCCT